rs1555165008

Variant names:

• chr11-64806274-TCCCGCACATTGCGGTTGCGACAGTGG-T
• rs1555165008
• NM_001370259.2:c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_001370259.2(MEN1):​c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG​(p.Tyr327fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as (no stars). Synonymous variant affecting the same amino acid position (i.e. Y327Y) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: MEN1 NM_001370259.2 frameshift
• Clinical Significance: Other O:1
• Conservation: PhyloP100: 6.37
• Publications: 1 publications found

Genes affected

MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]

MEN1 Gene-Disease associations (from GenCC):

• multiple endocrine neoplasia type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• familial isolated hyperparathyroidism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• pituitary gigantism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001370259.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MEN1	NM_001370259.2	MANE Select	c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG	p.Tyr327fs	frameshift	Exon 7 of 10	NP_001357188.2	O00255-2
	MEN1	NM_001407150.1		c.996_1021delCCACTGTCGCAACCGCAATGTGCGGG	p.Tyr332fs	frameshift	Exon 7 of 11	NP_001394079.1
	MEN1	NM_001370251.2		c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG	p.Tyr327fs	frameshift	Exon 7 of 11	NP_001357180.2	A0A5F9ZHS3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MEN1	ENST00000450708.7	TSL:5 MANE Select	c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG	p.Tyr327fs	frameshift	Exon 7 of 10	ENSP00000394933.3	O00255-2
	MEN1	ENST00000312049.11	TSL:1	c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG	p.Tyr327fs	frameshift	Exon 7 of 10	ENSP00000308975.6	O00255-2
	MEN1	ENST00000424912.2	TSL:1	c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG	p.Tyr327fs	frameshift	Exon 8 of 11	ENSP00000388016.2	O00255-2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Other

Revision:

Pathogenic	VUS	Benign	Condition
-	-	-	Neuroendocrine pancreatic tumor (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555165008; hg19: chr11-64573746; COSMIC: COSV53650373; COSMIC: COSV53650373;