rs1555165008

Variant names:

• chr11-64806274-TCCCGCACATTGCGGTTGCGACAGTGG-T
• rs1555165008
• NM_001370259.2:c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_001370259.2(MEN1):​c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG​(p.Tyr327fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as (no stars). Synonymous variant affecting the same amino acid position (i.e. Y327Y) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: MEN1 NM_001370259.2 frameshift
• Clinical Significance: - - O:1
• Conservation: PhyloP100: 6.37
• Publications: 1 publications found

Genes affected

MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]

MEN1 Gene-Disease associations (from GenCC):

• multiple endocrine neoplasia type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet, Ambry Genetics
• familial isolated hyperparathyroidism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• pituitary gigantism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MEN1	NM_001370259.2	c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG	p.Tyr327fs	frameshift_variant	Exon 7 of 10	ENST00000450708.7	NP_001357188.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MEN1	ENST00000450708.7	c.981_1006delCCACTGTCGCAACCGCAATGTGCGGG	p.Tyr327fs	frameshift_variant	Exon 7 of 10	5	NM_001370259.2	ENSP00000394933.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: -

Submissions summary: Other:1

Revision: -

Submissions by phenotype

Neuroendocrine pancreatic tumor Other:1

Nov 13, 2024

Genome Sciences Centre, British Columbia Cancer Agency

Significance: -

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555165008; hg19: chr11-64573746; COSMIC: COSV53650373; COSMIC: COSV53650373;