rs1555288389
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000059.4(BRCA2):c.8886_8950delATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATT(p.Leu2962fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
BRCA2
NM_000059.4 frameshift
NM_000059.4 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 7.91
Genes affected
BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 13-32379445-TTTATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGA-T is Pathogenic according to our data. Variant chr13-32379445-TTTATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGA-T is described in ClinVar as [Pathogenic]. Clinvar id is 462500.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
BRCA2 | NM_000059.4 | c.8886_8950delATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATT | p.Leu2962fs | frameshift_variant | 22/27 | ENST00000380152.8 | NP_000050.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
BRCA2 | ENST00000380152.8 | c.8886_8950delATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATT | p.Leu2962fs | frameshift_variant | 22/27 | 5 | NM_000059.4 | ENSP00000369497.3 | ||
BRCA2 | ENST00000530893.7 | c.8517_8581delATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATT | p.Leu2839fs | frameshift_variant | 22/27 | 1 | ENSP00000499438.2 | |||
BRCA2 | ENST00000614259.2 | n.*944_*1008delATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATT | non_coding_transcript_exon_variant | 21/26 | 2 | ENSP00000506251.1 | ||||
BRCA2 | ENST00000614259.2 | n.*944_*1008delATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATT | 3_prime_UTR_variant | 21/26 | 2 | ENSP00000506251.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Hereditary breast ovarian cancer syndrome Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 27, 2017 | For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss-of-function variants in BRCA2 are known to be pathogenic (PMID: 20104584). This sequence change deletes 65 nucleotides from exon 22 of the BRCA2 mRNA (c.8886_8950del), causing a frameshift at codon 2962. This creates a premature translational stop signal (p.Leu2962Phefs*34) and is expected to result in an absent or disrupted protein product. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at