rs1555514034

Variant names:

• chr16-2084355-C-CCTCGCAGCCCCTGAGCAAGTCCAGCT
• rs1555514034
• NM_000548.5:c.4135_4160dupTCGCAGCCCCTGAGCAAGTCCAGCTC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000548.5(TSC2):​c.4135_4160dupTCGCAGCCCCTGAGCAAGTCCAGCTC​(p.Ser1388ArgfsTer4) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. S1387S) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: TSC2 NM_000548.5 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -1.05
• Publications: 0 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC2 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
• lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-2084355-C-CCTCGCAGCCCCTGAGCAAGTCCAGCT is Pathogenic according to our data. Variant chr16-2084355-C-CCTCGCAGCCCCTGAGCAAGTCCAGCT is described in ClinVar as Pathogenic. ClinVar VariationId is 535912.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	NM_000548.5	MANE Select	c.4135_4160dupTCGCAGCCCCTGAGCAAGTCCAGCTC	p.Ser1388ArgfsTer4	frameshift stop_gained	Exon 34 of 42	NP_000539.2
	TSC2	NM_001406663.1		c.4132_4157dupTCGCAGCCCCTGAGCAAGTCCAGCTC	p.Ser1387ArgfsTer4	frameshift stop_gained	Exon 34 of 42	NP_001393592.1
	TSC2	NM_001114382.3		c.4066_4091dupTCGCAGCCCCTGAGCAAGTCCAGCTC	p.Ser1365ArgfsTer4	frameshift stop_gained	Exon 33 of 41	NP_001107854.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	ENST00000219476.9	TSL:5 MANE Select	c.4135_4160dupTCGCAGCCCCTGAGCAAGTCCAGCTC	p.Ser1388ArgfsTer4	frameshift stop_gained	Exon 34 of 42	ENSP00000219476.3
	TSC2	ENST00000350773.9	TSL:1	c.4066_4091dupTCGCAGCCCCTGAGCAAGTCCAGCTC	p.Ser1365ArgfsTer4	frameshift stop_gained	Exon 33 of 41	ENSP00000344383.4
	TSC2	ENST00000401874.7	TSL:1	c.3934_3959dupTCGCAGCCCCTGAGCAAGTCCAGCTC	p.Ser1321ArgfsTer4	frameshift stop_gained	Exon 32 of 40	ENSP00000384468.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Tuberous sclerosis 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-1.0
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555514034; hg19: chr16-2134356;