rs1555723585

Variant names:

• chr19-36101700-T-TCGCAGCCATCCACTCCCCAGCTC
• rs1555723585
• NM_001083961.2:c.3012_3034dupAGCCATCCACTCCCCAGCTCCGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001083961.2(WDR62):​c.3012_3034dupAGCCATCCACTCCCCAGCTCCGC​(p.Pro1012GlnfsTer64) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: WDR62 NM_001083961.2 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -1.77
• Publications: 0 publications found

Genes affected

WDR62 (HGNC:24502): (WD repeat domain 62) This gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]

WDR62 Gene-Disease associations (from GenCC):

• microcephaly 2, primary, autosomal recessive, with or without cortical malformations

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, Ambry Genetics, Illumina, G2P, ClinGen
• autosomal recessive primary microcephaly

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 19-36101700-T-TCGCAGCCATCCACTCCCCAGCTC is Pathogenic according to our data. Variant chr19-36101700-T-TCGCAGCCATCCACTCCCCAGCTC is described in ClinVar as Pathogenic. ClinVar VariationId is 437292.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
WDR62	NM_001083961.2	c.3012_3034dupAGCCATCCACTCCCCAGCTCCGC	p.Pro1012GlnfsTer64	frameshift_variant	Exon 25 of 32	ENST00000401500.7	NP_001077430.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
WDR62	ENST00000401500.7	c.3012_3034dupAGCCATCCACTCCCCAGCTCCGC	p.Pro1012GlnfsTer64	frameshift_variant	Exon 25 of 32	1	NM_001083961.2	ENSP00000384792.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Microcephaly 2, primary, autosomal recessive, with or without cortical malformations Pathogenic:1

Mar 16, 2017

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-1.8
Mutation Taster		=52/148	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555723585; hg19: chr19-36592602;