rs1555790419
Variant summary
Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2
The NM_002691.4(POLD1):c.1049_1070dupTCCTACGCCTGGCGCTCACCCT(p.Arg358ProfsTer284) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002691.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 10 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
POLD1 | NM_002691.4 | c.1049_1070dupTCCTACGCCTGGCGCTCACCCT | p.Arg358ProfsTer284 | frameshift_variant | Exon 9 of 27 | ENST00000440232.7 | NP_002682.2 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Colorectal cancer, susceptibility to, 10 Uncertain:1
This sequence change creates a premature translational stop signal (p.Arg358Profs*284) in the POLD1 gene. It is expected to result in an absent or disrupted protein product. However, the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in POLD1 cause disease. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 412518). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at