rs1555790419

Variant names:

• chr19-50403126-G-GCCCTTCCTACGCCTGGCGCTCA
• rs1555790419
• NM_002691.4:c.1049_1070dupTCCTACGCCTGGCGCTCACCCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_002691.4(POLD1):​c.1049_1070dupTCCTACGCCTGGCGCTCACCCT​(p.Arg358ProfsTer284) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. L357L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: POLD1 NM_002691.4 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.43
• Publications: 0 publications found

Genes affected

POLD1 (HGNC:9175): (DNA polymerase delta 1, catalytic subunit) This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]

POLD1 Gene-Disease associations (from GenCC):

• POLD1-related polyposis and colorectal cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• colorectal cancer, susceptibility to, 10

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
• mandibular hypoplasia-deafness-progeroid syndrome

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, Orphanet, G2P
• Polymerase proofreading-related adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• immunodeficiency 120

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
• non-severe combined immunodeficiency due to polymerase delta deficiency

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLD1	NM_002691.4	c.1049_1070dupTCCTACGCCTGGCGCTCACCCT	p.Arg358ProfsTer284	frameshift_variant	Exon 9 of 27	ENST00000440232.7	NP_002682.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLD1	ENST00000440232.7	c.1049_1070dupTCCTACGCCTGGCGCTCACCCT	p.Arg358ProfsTer284	frameshift_variant	Exon 9 of 27	1	NM_002691.4	ENSP00000406046.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Colorectal cancer, susceptibility to, 10 Uncertain:1

Dec 18, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Arg358Profs*284) in the POLD1 gene. It is expected to result in an absent or disrupted protein product. However, the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in POLD1 cause disease. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 412518). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555790419; hg19: chr19-50906383;