rs1555790419

Positions:

• chr19-50403126-G-GCCCTTCCTACGCCTGGCGCTCA

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_002691.4(POLD1):​c.1049_1070dupTCCTACGCCTGGCGCTCACCCT​(p.Arg358fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: POLD1 NM_002691.4 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.43

Genes affected

POLD1 (HGNC:9175): (DNA polymerase delta 1, catalytic subunit) This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]

POLD1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
POLD1	NM_002691.4	c.1049_1070dupTCCTACGCCTGGCGCTCACCCT	p.Arg358fs	frameshift_variant	9/27	ENST00000440232.7	NP_002682.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
POLD1	ENST00000440232.7	c.1049_1070dupTCCTACGCCTGGCGCTCACCCT	p.Arg358fs	frameshift_variant	9/27	1	NM_002691.4	ENSP00000406046.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Colorectal cancer, susceptibility to, 10 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 18, 2023

This sequence change creates a premature translational stop signal (p.Arg358Profs*284) in the POLD1 gene. It is expected to result in an absent or disrupted protein product. However, the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in POLD1 cause disease. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 412518). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555790419; hg19: chr19-50906383;