rs1555792829

Variant names:

• chr19-50414858-G-GCCTGCTCTTCTCCTCCCGGC
• rs1555792829
• NM_002691.4:c.2435_2454dupTGCTCTTCTCCTCCCGGCCC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_002691.4(POLD1):​c.2435_2454dupTGCTCTTCTCCTCCCGGCCC​(p.Asp819CysfsTer76) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: POLD1 NM_002691.4 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.181

Genes affected

POLD1 (HGNC:9175): (DNA polymerase delta 1, catalytic subunit) This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLD1	NM_002691.4	c.2435_2454dupTGCTCTTCTCCTCCCGGCCC	p.Asp819CysfsTer76	frameshift_variant	Exon 20 of 27	ENST00000440232.7	NP_002682.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLD1	ENST00000440232.7	c.2435_2454dupTGCTCTTCTCCTCCCGGCCC	p.Asp819CysfsTer76	frameshift_variant	Exon 20 of 27	1	NM_002691.4	ENSP00000406046.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Colorectal cancer, susceptibility to, 10 Uncertain:1

Nov 30, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Missense variants that disrupt the 3'-5' exonuclease (proof-reading) activity of the POLD1 protein, while not abolishing its polymerase enzyme activity, are associated with an increased risk for colonic adenomatous polyps and colon cancer (PMID: 23263490, 23447401). Loss-of-function truncating variants, which result in an absent or severely disrupted POLD1 protein, are therefore unlikely to be associated with disease. Without further clinical and genetic evidence, however, this variant has been classified as a Variant of Uncertain Significance. This variant has not been reported in the literature in individuals with POLD1-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Asp819Cysfs*76) in the POLD1 gene. It is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555792829; hg19: chr19-50918115;