rs1555913672

Variant names:

• chr22-28695735-TCCAGCAGTCCACAGCACGGTTATAC-T
• rs1555913672
• NM_007194.4:c.1209_1233delGTATAACCGTGCTGTGGACTGCTGG

Your query was ambiguous. Multiple possible variants found:

• chr22-28695735-TCCAGCAGTCCACAGCACGGTTATAC-T
• chr22-28695735-TCCAGCAGTCCACAGCACGGTTATAC-TCCAGCAGTCCACAGCACGGTTATACCCAGCAGTCCACAGCACGGTTATAC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_007194.4(CHEK2):​c.1209_1233delGTATAACCGTGCTGTGGACTGCTGG​(p.Tyr404ValfsTer2) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G403G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CHEK2 NM_007194.4 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 8.08
• Publications: 1 publications found

Genes affected

CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

CHEK2 Gene-Disease associations (from GenCC):

• CHEK2-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen
• Li-Fraumeni syndrome 2

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• acute myeloid leukemia

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary nonpolyposis colon cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• familial ovarian cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 22-28695735-TCCAGCAGTCCACAGCACGGTTATAC-T is Pathogenic according to our data. Variant chr22-28695735-TCCAGCAGTCCACAGCACGGTTATAC-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 491592.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CHEK2	NM_007194.4	c.1209_1233delGTATAACCGTGCTGTGGACTGCTGG	p.Tyr404ValfsTer2	frameshift_variant	Exon 11 of 15	ENST00000404276.6	NP_009125.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CHEK2	ENST00000404276.6	c.1209_1233delGTATAACCGTGCTGTGGACTGCTGG	p.Tyr404ValfsTer2	frameshift_variant	Exon 11 of 15	1	NM_007194.4	ENSP00000385747.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 6.84e-7 AC: 1 AN: 1461554 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727104

African (AFR) AF: 0.00 AC: 0 AN: 33464

American (AMR) AF: 0.00 AC: 0 AN: 44714

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86248

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5762

European-Non Finnish (NFE) AF: 8.99e-7 AC: 1 AN: 1111738

Other (OTH) AF: 0.00 AC: 0 AN: 60376

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial cancer of breast Pathogenic:3

Apr 02, 2021

Baylor Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jun 28, 2023

Myriad Genetics, Inc.

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Nov 03, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Tyr404Valfs*2) in the CHEK2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CHEK2 are known to be pathogenic (PMID: 21876083, 24713400). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CHEK2-related conditions. ClinVar contains an entry for this variant (Variation ID: 491592). For these reasons, this variant has been classified as Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:2

Mar 06, 2023

Color Diagnostics, LLC DBA Color Health

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant deletes 25 nucleotides in exon 11 of the CHEK2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in an individual affected with breast cancer in the literature (PMID: 34072659). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of CHEK2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Jun 01, 2023

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1209_1233del25 pathogenic mutation, located in coding exon 10 of the CHEK2 gene, results from a deletion of 25 nucleotides at nucleotide positions 1209 to 1233, causing a translational frameshift with a predicted alternate stop codon (p.Y404Vfs*2). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.1
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555913672; hg19: chr22-29091723;