rs1555926975

Variant names:

• chr22-28725096-GCAATGTAAGAGTTTTTAGGACC-G
• rs1555926975
• NM_007194.4:c.451_472delGGTCCTAAAAACTCTTACATTG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_007194.4(CHEK2):​c.451_472delGGTCCTAAAAACTCTTACATTG​(p.Gly151HisfsTer3) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CHEK2 NM_007194.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 6.65

Genes affected

CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 22-28725096-GCAATGTAAGAGTTTTTAGGACC-G is Pathogenic according to our data. Variant chr22-28725096-GCAATGTAAGAGTTTTTAGGACC-G is described in ClinVar as [Pathogenic]. Clinvar id is 491615.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CHEK2	NM_007194.4	c.451_472delGGTCCTAAAAACTCTTACATTG	p.Gly151HisfsTer3	frameshift_variant	Exon 4 of 15	ENST00000404276.6	NP_009125.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CHEK2	ENST00000404276.6	c.451_472delGGTCCTAAAAACTCTTACATTG	p.Gly151HisfsTer3	frameshift_variant	Exon 4 of 15	1	NM_007194.4	ENSP00000385747.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:2

Sep 02, 2020

Color Diagnostics, LLC DBA Color Health

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant deletes 22 nucleotides in exon 4 of the CHEK2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. To our knowledge, this variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of CHEK2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Dec 23, 2024

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.451_472del22 pathogenic mutation, located in coding exon 3 of the CHEK2 gene, results from a deletion of 22 nucleotides at nucleotide positions 451 to 472, causing a translational frameshift with a predicted alternate stop codon (p.G151Hfs*3). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Familial cancer of breast Pathogenic:1

Jun 23, 2023

Myriad Genetics, Inc.

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555926975; hg19: chr22-29121084;