rs1555926975
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_007194.4(CHEK2):c.451_472delGGTCCTAAAAACTCTTACATTG(p.Gly151HisfsTer3) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G151G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_007194.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- CHEK2-related cancer predispositionInheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics, ClinGen
- Li-Fraumeni syndrome 2Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
- hereditary breast carcinomaInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- acute myeloid leukemiaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary nonpolyposis colon cancerInheritance: Unknown Classification: LIMITED Submitted by: ClinGen
- familial ovarian cancerInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_007194.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CHEK2 | MANE Select | c.451_472delGGTCCTAAAAACTCTTACATTG | p.Gly151HisfsTer3 | frameshift | Exon 4 of 15 | NP_009125.1 | O96017-1 | ||
| CHEK2 | c.580_601delGGTCCTAAAAACTCTTACATTG | p.Gly194HisfsTer3 | frameshift | Exon 5 of 16 | NP_001005735.1 | ||||
| CHEK2 | c.544_565delGGTCCTAAAAACTCTTACATTG | p.Gly182HisfsTer3 | frameshift | Exon 5 of 16 | NP_001425222.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CHEK2 | TSL:1 MANE Select | c.451_472delGGTCCTAAAAACTCTTACATTG | p.Gly151HisfsTer3 | frameshift | Exon 4 of 15 | ENSP00000385747.1 | O96017-1 | ||
| CHEK2 | TSL:1 | c.580_601delGGTCCTAAAAACTCTTACATTG | p.Gly194HisfsTer3 | frameshift | Exon 5 of 16 | ENSP00000372023.2 | O96017-9 | ||
| CHEK2 | TSL:1 | c.444+125_444+146delGGTCCTAAAAACTCTTACATTG | intron | N/A | ENSP00000384835.2 | A0A7P0MUT5 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.