rs1555926975
Positions:
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_007194.4(CHEK2):c.451_472delGGTCCTAAAAACTCTTACATTG(p.Gly151fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
CHEK2
NM_007194.4 frameshift
NM_007194.4 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 6.65
Genes affected
CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 22-28725096-GCAATGTAAGAGTTTTTAGGACC-G is Pathogenic according to our data. Variant chr22-28725096-GCAATGTAAGAGTTTTTAGGACC-G is described in ClinVar as [Pathogenic]. Clinvar id is 491615.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CHEK2 | NM_007194.4 | c.451_472delGGTCCTAAAAACTCTTACATTG | p.Gly151fs | frameshift_variant | 4/15 | ENST00000404276.6 | NP_009125.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CHEK2 | ENST00000404276.6 | c.451_472delGGTCCTAAAAACTCTTACATTG | p.Gly151fs | frameshift_variant | 4/15 | 1 | NM_007194.4 | ENSP00000385747.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Hereditary cancer-predisposing syndrome Pathogenic:2
Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Nov 18, 2020 | The c.451_472del22 pathogenic mutation, located in coding exon 3 of the CHEK2 gene, results from a deletion of 22 nucleotides at nucleotide positions 451 to 472, causing a translational frameshift with a predicted alternate stop codon (p.G151Hfs*3). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. - |
Pathogenic, criteria provided, single submitter | clinical testing | Color Diagnostics, LLC DBA Color Health | Sep 02, 2020 | This variant deletes 22 nucleotides in exon 4 of the CHEK2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. To our knowledge, this variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of CHEK2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. - |
Familial cancer of breast Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Myriad Genetics, Inc. | Jun 23, 2023 | This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at