rs199422264
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5
The ENST00000602385.3(TERC):n.53_87delTAACTGAGAAGGGCGTAGGCGCCGTGCTTTTGCTC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
ENST00000602385.3 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- dyskeratosis congenita, autosomal dominant 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- acute myeloid leukemiaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000602385.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TERC | NR_001566.3 | MANE Select | n.53_87delTAACTGAGAAGGGCGTAGGCGCCGTGCTTTTGCTC | non_coding_transcript_exon | Exon 1 of 1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TERC | ENST00000602385.3 | TSL:6 MANE Select | n.53_87delTAACTGAGAAGGGCGTAGGCGCCGTGCTTTTGCTC | non_coding_transcript_exon | Exon 1 of 1 | ||||
| ENSG00000296372 | ENST00000738610.1 | n.590_624delAGCAAAAGCACGGCGCCTACGCCCTTCTCAGTTAG | non_coding_transcript_exon | Exon 1 of 1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at