rs377767365

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_005359.6(SMAD4):​c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG​(p.Gly471LeufsTer25) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. G471G) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

SMAD4
NM_005359.6 frameshift

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: 9.83

Publications

2 publications found
Variant links:
Genes affected
SMAD4 (HGNC:6770): (SMAD family member 4) This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to transforming growth factor (TGF)-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The protein acts as a tumor suppressor and inhibits epithelial cell proliferation. It may also have an inhibitory effect on tumors by reducing angiogenesis and increasing blood vessel hyperpermeability. The encoded protein is a crucial component of the bone morphogenetic protein signaling pathway. The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, May 2022]
SMAD4 Gene-Disease associations (from GenCC):
  • juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, G2P, PanelApp Australia
  • Myhre syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, G2P, Labcorp Genetics (formerly Invitae)
  • generalized juvenile polyposis/juvenile polyposis coli
    Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
  • juvenile polyposis syndrome
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • familial thoracic aortic aneurysm and aortic dissection
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • hereditary hemorrhagic telangiectasia
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • pulmonary arterial hypertension
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 44 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SMAD4NM_005359.6 linkc.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG p.Gly471LeufsTer25 frameshift_variant Exon 11 of 12 ENST00000342988.8 NP_005350.1 Q13485A0A024R274
SMAD4NM_001407041.1 linkc.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG p.Gly471LeufsTer25 frameshift_variant Exon 11 of 12 NP_001393970.1
SMAD4NM_001407042.1 linkc.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG p.Gly471LeufsTer25 frameshift_variant Exon 11 of 12 NP_001393971.1
SMAD4NR_176265.1 linkn.1949_1973delGGCCCAGGATCAGTAGGTGGAATAG non_coding_transcript_exon_variant Exon 11 of 13

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SMAD4ENST00000342988.8 linkc.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG p.Gly471LeufsTer25 frameshift_variant Exon 11 of 12 5 NM_005359.6 ENSP00000341551.3 Q13485

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.8
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs377767365; hg19: chr18-48603109; API