rs377767365
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_005359.6(SMAD4):c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG(p.Gly471LeufsTer25) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. G471G) has been classified as Likely benign.
Frequency
Consequence
NM_005359.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- juvenile polyposis/hereditary hemorrhagic telangiectasia syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, G2P, PanelApp Australia
- Myhre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, G2P, Labcorp Genetics (formerly Invitae)
- generalized juvenile polyposis/juvenile polyposis coliInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- juvenile polyposis syndromeInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- familial thoracic aortic aneurysm and aortic dissectionInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary hemorrhagic telangiectasiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- pulmonary arterial hypertensionInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SMAD4 | NM_005359.6 | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift_variant | Exon 11 of 12 | ENST00000342988.8 | NP_005350.1 | |
SMAD4 | NM_001407041.1 | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift_variant | Exon 11 of 12 | NP_001393970.1 | ||
SMAD4 | NM_001407042.1 | c.1411_1435delGGCCCAGGATCAGTAGGTGGAATAG | p.Gly471LeufsTer25 | frameshift_variant | Exon 11 of 12 | NP_001393971.1 | ||
SMAD4 | NR_176265.1 | n.1949_1973delGGCCCAGGATCAGTAGGTGGAATAG | non_coding_transcript_exon_variant | Exon 11 of 13 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at