rs397514444

Variant names:

• chr11-47332267-AAGGTAAAGAGAGGGAGGGAAGCCAT-A
• rs397514444
• NM_000256.3:c.3628-34_3628-10delATGGCTTCCCTCCCTCTCTTTACCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000256.3(MYBPC3):​c.3628-34_3628-10delATGGCTTCCCTCCCTCTCTTTACCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as risk factor (no stars). The gene MYBPC3 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 33)
• Consequence: MYBPC3 NM_000256.3 intron
• Clinical Significance: risk factor no assertion criteria provided O:1
• Conservation: PhyloP100: 1.16
• Publications: 0 publications found

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

MYBPC3 Gene-Disease associations (from GenCC):

• hypertrophic cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• hypertrophic cardiomyopathy 4

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• left ventricular noncompaction 10

  Inheritance: AD, AR Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• atrial fibrillation

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• congenital heart disease

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• dilated cardiomyopathy

  Inheritance: AR, AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Specifications for MYBPC3 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000256.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYBPC3	NM_000256.3	MANE Select	c.3628-34_3628-10delATGGCTTCCCTCCCTCTCTTTACCT		intron	N/A	NP_000247.2	Q14896-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYBPC3	ENST00000545968.6	TSL:5 MANE Select	c.3628-34_3628-10delATGGCTTCCCTCCCTCTCTTTACCT		intron	N/A	ENSP00000442795.1	Q14896-1
	MYBPC3	ENST00000399249.6	TSL:5	c.3628-34_3628-10delATGGCTTCCCTCCCTCTCTTTACCT		intron	N/A	ENSP00000382193.2	A8MXZ9

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: risk factor

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	-	-	Cardiomyopathy, familial hypertrophic, 4, susceptibility to (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397514444; hg19: chr11-47353818;