rs397516667
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001399.5(EDA):c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC(p.Pro188ArgfsTer83) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P188P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001399.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- tooth agenesis, selective, X-linked, 1Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- X-linked hypohidrotic ectodermal dysplasiaInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P
- tooth agenesisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001399.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| EDA | MANE Select | c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC | p.Pro188ArgfsTer83 | frameshift | Exon 4 of 8 | NP_001390.1 | Q92838-1 | ||
| EDA | c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC | p.Pro188ArgfsTer83 | frameshift | Exon 4 of 8 | NP_001005609.1 | Q92838-3 | |||
| EDA | c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC | p.Pro188ArgfsTer80 | frameshift | Exon 4 of 8 | NP_001427690.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| EDA | TSL:1 MANE Select | c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC | p.Pro188ArgfsTer83 | frameshift | Exon 4 of 8 | ENSP00000363680.4 | Q92838-1 | ||
| EDA | TSL:1 | c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC | p.Pro188ArgfsTer83 | frameshift | Exon 4 of 8 | ENSP00000363681.2 | Q92838-3 | ||
| EDA | TSL:1 | c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC | p.Pro188ArgfsTer80 | frameshift | Exon 4 of 8 | ENSP00000432585.1 | Q92838-9 |
Frequencies
GnomAD3 genomes Cov.: 21
GnomAD4 genome Cov.: 21
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.