rs397516667

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_001399.5(EDA):​c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC​(p.Pro188ArgfsTer83) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 21)

Consequence

EDA
NM_001399.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 8.96
Variant links:
Genes affected
EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T is Pathogenic according to our data. Variant chrX-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T is described in ClinVar as [Pathogenic]. Clinvar id is 44199.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chrX-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
EDANM_001399.5 linkc.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC p.Pro188ArgfsTer83 frameshift_variant Exon 4 of 8 ENST00000374552.9 NP_001390.1 Q92838-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
EDAENST00000374552.9 linkc.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC p.Pro188ArgfsTer83 frameshift_variant Exon 4 of 8 1 NM_001399.5 ENSP00000363680.4 Q92838-1

Frequencies

GnomAD3 genomes
Cov.:
21
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
21

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hypohidrotic X-linked ectodermal dysplasia Pathogenic:1
Feb 22, 2012
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The Pro188fs variant (EDA) has been reported as a de novo variant in one individ ual with X-linked hypohidrotic ectodermal dysplasia (Monreal 1998). This framesh ift variant is predicted to alter the protein?s amino acid sequence beginning at position 188 and lead to a premature termination codon 83 amino acids downstrea m. This alteration is then predicted to lead to a truncated or absent protein. L oss of function of the EDA gene is an established disease mechanism in X-linked hypohidrotic ectodermal dysplasia. In summary, this variant meets our criteria t o be classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs397516667; hg19: chrX-69247741; API