rs61752992
Variant summary
Our verdict is Pathogenic. The variant received 17 ACMG points: 17P and 0B. PVS1PS2PM2_SupportingPS4
This summary comes from the ClinGen Evidence Repository: The p.Pro389* variant in MECP2 is predicted to cause a premature stop codon that leads to a truncated or absent protein where loss-of-function is an established mechanism. There is significant evidence that loss of this region of the gene is pathogenic (PVS1). The p.Pro389* variant in MECP2 has been reported as a de novo occurrence (biological parentage confirmed) in at least 2 individuals with Rett syndrome (internal database, GeneDx) (PS2_very strong). This variant has been observed in at least 5 other individuals with Rett syndrome (PMID 26984561, 21982064, 20151026, 19652677, RettBASE) (PS4). The p.Pro389* variant in MECP2 is absent from gnomAD (PM2_supporting). In summary, the p.Pro389* variant in MECP2 is classified as Pathogenic for Rett syndrome based on the ACMG/AMP criteria (PVS1, PS2_very strong, PS4, PM2_supporting). LINK:https://erepo.genome.network/evrepo/ui/classification/CA198846/MONDO:0010726/016
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Ambry Genetics, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 17 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | NM_001110792.2 | MANE Select | c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro401fs | frameshift | Exon 3 of 3 | NP_001104262.1 | A0A140VKC4 | |
| MECP2 | NM_004992.4 | MANE Plus Clinical | c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro389fs | frameshift | Exon 4 of 4 | NP_004983.1 | D3YJ43 | |
| MECP2 | NM_001316337.2 | c.885_928delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro296fs | frameshift | Exon 5 of 5 | NP_001303266.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | ENST00000453960.7 | TSL:1 MANE Select | c.1200_1243delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro401fs | frameshift | Exon 3 of 3 | ENSP00000395535.2 | P51608-2 | |
| MECP2 | ENST00000303391.11 | TSL:1 MANE Plus Clinical | c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro389fs | frameshift | Exon 4 of 4 | ENSP00000301948.6 | P51608-1 | |
| MECP2 | ENST00000630151.3 | TSL:5 | c.1164_1207delACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACCAGCCCCC | p.Pro389fs | frameshift | Exon 4 of 4 | ENSP00000486089.2 | P51608-1 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD4 exome AF: 9.14e-7 AC: 1AN: 1094103Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 361233 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 17
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at