rs63749748

Variant names:

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_001110792.2(MECP2):c.1193_1236delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC(p.Leu398GlnfsTer4) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. L398L) has been classified as Benign.

Frequency

Genomes: not found (cov: 17)

Consequence

MECP2
NM_001110792.2 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:24

Conservation

PhyloP100: 3.50

Publications

6 publications found

Variant links:

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

chromosome Xq28 duplication syndrome
Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
Rett syndrome
Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
severe neonatal-onset encephalopathy with microcephaly
Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
syndromic X-linked intellectual disability Lubs type
Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
atypical Rett syndrome
Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
non-syndromic X-linked intellectual disability
Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
X-linked intellectual disability-psychosis-macroorchidism syndrome
Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
systemic lupus erythematosus
Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

MECP2 links:

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1

Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 157 pathogenic variants in the truncated region.

PP5

Variant X-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-T is Pathogenic according to our data. Variant chrX-154030627-TGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 143372.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MECP2	NM_001110792.2 link	c.1193_1236delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu398GlnfsTer4	frameshift_variant	Exon 3 of 3	ENST00000453960.7	NP_001104262.1
MECP2	NM_004992.4 link	c.1157_1200delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu386GlnfsTer4	frameshift_variant	Exon 4 of 4	ENST00000303391.11	NP_004983.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MECP2	ENST00000453960.7 link	c.1193_1236delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu398GlnfsTer4	frameshift_variant	Exon 3 of 3	1	NM_001110792.2	ENSP00000395535.2
MECP2	ENST00000303391.11 link	c.1157_1200delTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC	p.Leu386GlnfsTer4	frameshift_variant	Exon 4 of 4	1	NM_004992.4	ENSP00000301948.6

Frequencies

GnomAD3 genomes

Cov.:

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome

Cov.:

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:24

Revision: criteria provided, multiple submitters, no conflicts

LINK: link

Submissions by phenotype

Rett syndrome

Pathogenic:14

Juno Genomics, Hangzhou Juno Genomics, Inc

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

PM2_Supporting+PVS1+PS4+PP4+PM6_VeryStrong -

Feb 08, 2013

Genetic Services Laboratory, University of Chicago

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

- -

Dec 07, 2023

3billion

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

The variant is not observed in the gnomAD v2.1.1 dataset. Predicted Consequence/Location: Frameshift: predicted to result in a loss or disruption of normal protein function through protein truncation. The predicted truncated protein may be shortened by more than 10%. The variant has been reported at least twice as pathogenic with clinical assertions and evidence for the classification (ClinVar ID: VCV000143372 /PMID: 10814718 /3billion dataset). Therefore, this variant is classified as Pathogenic according to the recommendation of ACMG/AMP guideline. -

Apr 25, 2025

Institute of Human Genetics, University of Leipzig Medical Center

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

Criteria applied: PVS1_STR,PS2,PS4,PM2_SUP -

May 28, 2019

Mendelics

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

- -

Mar 15, 2022

Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

ACMG classification criteria: PVS1 very strong, PS4 strong, PM2 moderated -

Nov 22, 2023

Centre for Population Genomics, CPG

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). (PMIDs: 11738883‚ 15737703‚ 10814718‚ 11269512‚ 11283202‚ 11313756‚ 12567420‚ 16473305‚ 17387578‚ 19371229‚ 22525432, ClinVar database(Variation ID: 143372) This variant is absent from gnomAD (PM2_Supporting). -

Sep 27, 2012

RettBASE

Significance:Pathogenic

Review Status:no assertion criteria provided

Collection Method:curation

- -

Jul 22, 2023

Neuberg Centre For Genomic Medicine, NCGM

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

The observed frameshift variant c.1193_1236delp.Leu398GlnfsTer4 in MECP2 gene has been reported previously in heterozygous state in multiple individuals with Rett syndrome Fendri-Kriaa N, et al., 2012, Todorov T, et al., 2012. The p.Leu398GlnfsTer4 variant is absent in gnomAD Exomes. It has been submitted to ClinVar as Pathogenic multiple submissions. According to study by Invitae, this variant disrupts a region of the MECP2 protein in which other variants p.Tyr450Leufs*37 have been determined to be Pathogenic. This variant causes a frameshift starting with codon Leucine 398, changes this amino acid to Glutamine residue, and creates a premature Stop codon at position 4 of the new reading frame, denoted p.Leu398GlnfsTer4. This variant is predicted to cause loss of normal protein function through protein truncation. Loss of function variants have been previously reported to be disease causing. For these reasons, this variant has been classified as Pathogenic. -

Jul 09, 2015

Athena Diagnostics

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

- -

Jul 02, 2020

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

Variant summary: MECP2 c.1157_1200del44 (p.Leu386GlnfsX4) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant was absent in 176334 control chromosomes (gnomAD). c.1157_1200del44 has been reported in the literature in multiple individuals affected with Rett Syndrome (e.g. Huppke_2000, Khajuria_2009, Vacca_2001, Weaving_2003). These data indicate that the variant is very likely to be associated with disease. Five ClinVar submitters (evaluation after 2014) cite the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Jan 05, 2022

DASA

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

The c.1157_1200del;p.(Leu386Glnfs*4) is a null frameshift variant (NMD) in the MECP2 gene and predicts alteration of the nonsense-mediate decay - NMD is present in a relevantexon to the transcript -PVS1_strong. This sequence change has been observed in affected individual(s) and ClinVar contains an entry for this variant (Clinvar ID: 143372; PMID: 16473305; 22561697; 22525432; 19914908; 19371229; 17387578) - PS4. This variant is not present in population databases (rs63749748, gnomAD; ABraOM no frequency - http://abraom.ib.usp.br/) - PM2. The variant was assumed de novo, but without confirmation of paternity and maternity (PMID: 12655490) - PM6. In summary, the currently available evidence indicates that the variant is pathogenic. -

Molecular Genetics Laboratory, Children's Mercy Hospital and Clinics

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

- -

Oct 04, 2024

Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:research

PVS1,PS2,PM2 -

not provided

Pathogenic:7

Jul 27, 2017

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

The MECP2 c.1157_1200del; p.Leu386fs variant (rs63749748) has been reported in the literature in several individuals affected with Rett syndrome (Huppke 2000, Khajuria 2009, Vacca 2001, see RettBASE and references therein). It is reported in the ClinVar database as pathogenic (Variation ID: 143372), and is absent from general population databases (1000 Genome Project, Exome Variant Server, Genome Aggregation Database). This variant creates a frameshift and is predicted to result in a truncated protein or absent transcript. Based on the above information, this variant is considered pathogenic. REFERENCES Link to ClinVar database for c.1157_1200del: https://www.ncbi.nlm.nih.gov/clinvar/variation/143372/ Link to RettBASE variation database: http://mecp2.chw.edu.au/cgi-bin/mecp2/views/basic.cgi?form=basic Huppke P et al. Rett syndrome: analysis of MECP2 and clinical characterization of 31 patients. Hum Mol Genet. 2000 May 22;9(9):1369-75. Khajuria R et al. Rapid detection of deletions in hotspot C-terminal segment region of MECP2 by routine PCR method: report of two classical Rett syndrome patients of Indian origin. Genet Test Mol Biomarkers. 2009 Apr;13(2):277-80. Vacca M et al. Mutation analysis of the MECP2 gene in British and Italian Rett syndrome females. J Mol Med (Berl). 2001;78(11):648-55. -

Oct 23, 2020

Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

- -

Feb 01, 2019

CeGaT Center for Human Genetics Tuebingen

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

- -

Aug 14, 2021

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

The frameshift variant causes the premature termination of MECP2 protein synthesis. In addition, it has been reported in individuals with Rett syndrome in the published literature (PMID: 17387578 (2007), 12655490 (2003), 12567420 (2003), 11313756 (2001), 10814718 (2000)). Therefore, the variant is classified as pathogenic. -

Jan 11, 2018

Clinical Genetics and Genomics, Karolinska University Hospital

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

- -

Oct 29, 2019

Revvity Omics, Revvity

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

- -

Nov 09, 2022

GeneDx

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

Frameshift variant predicted to result in protein truncation in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 26984561, 22561697, 16077736, 23696494, 27090848, 19914908, 19371229, 10814718) -

Severe neonatal-onset encephalopathy with microcephaly

Pathogenic:1

Jun 28, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

This sequence change creates a premature translational stop signal (p.Leu386Glnfs*4) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individuals with Rett syndrome (PMID: 10814718, 17387578, 19371229, 19914908, 22525432). ClinVar contains an entry for this variant (Variation ID: 143372). This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Tyr450Leufs*37) have been determined to be pathogenic (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Angelman syndrome

Pathogenic:1

Sep 27, 2012

RettBASE

Significance:Pathogenic

Review Status:no assertion criteria provided

Collection Method:curation

- -

MECP2-related disorder

Pathogenic:1

Sep 23, 2022

PreventionGenetics, part of Exact Sciences

Significance:Pathogenic

Review Status:criteria provided, single submitter

Collection Method:clinical testing

The MECP2 c.1157_1200del44 variant is predicted to result in a frameshift and premature protein termination (p.Leu386Glnfs*4). This is a recurrent de novo variant reported in female individuals with Rett syndrome (Table 1, Huppke et al. 2000. PubMed ID: 10814718; Table 2, referred to as 1158del44bp, Giunti et al. 2001. PubMed ID: 11738883; Table 1, referred to as 1156-1199del, Nielsen et al. 2001. PubMed ID: 11313756; Table 1, referred to as 1156-1199del, Nielsen et al. 2001. PubMed ID: 11738879; Table 1, Vacca et al. 2001. PubMed ID: 11269512; Table 2, referred to as 1230del44, Watson et al. 2001. PubMed ID: 11283202; Table 1, Zahorakova et al. 2007. PubMed ID: 17387578; Fendri-Kriaa et al. 2012. PubMed ID: 22561697; Table S1, Wen et al. 2020. PubMed ID: 32472557). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. It is interpreted as pathogenic in ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/variation/143372/). Frameshift variants in MECP2 are expected to be pathogenic. This variant is interpreted as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name

Calibrated prediction

Score

Prediction

PhyloP100

3.5

Mutation Taster

=0/200

disease causing (ClinVar)

(source)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

You must be logged in to view publications. This limit was set because tens of millions (!) of queries from AI bots are generated daily.

Variant summary

Frequency

Consequence

Scores

Clinical Significance

Conservation

Publications

ACMG classification

Transcripts

RefSeq

Ensembl

Frequencies

ClinVar

Submissions by phenotype

Computational scores

Splicing

Publications

Other links and lift over