rs63750122

Variant names:

• chr16-176981-AGCCACGGCTCTGCCCAGGTTAAGG-A
• rs63750122
• NM_000558.5:c.157_180delTCTGCCCAGGTTAAGGGCCACGGC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_000558.5(HBA1):​c.157_180delTCTGCCCAGGTTAAGGGCCACGGC​(p.Ser53_Gly60del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as other (no stars).

• Frequency: Genomes: not found (cov: 30)
• Consequence: HBA1 NM_000558.5 conservative_inframe_deletion
• Clinical Significance: other no assertion criteria provided O:1
• Conservation: PhyloP100: 7.18
• Publications: 1 publications found

Genes affected

HBA1 (HGNC:4823): (hemoglobin subunit alpha 1) The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]

HBA1 Gene-Disease associations (from GenCC):

• alpha thalassemia spectrum

  Inheritance: AR, SD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• erythrocytosis, familial, 7

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• hemoglobin M disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Hb Bart's hydrops fetalis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hemoglobin H disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• methemoglobinemia, alpha type

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• Heinz body anemia

  Inheritance: AR Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000294436 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 4 benign, 30 uncertain in NM_000558.5
• PM4: Nonframeshift variant in NON repetitive region in NM_000558.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HBA1	NM_000558.5	c.157_180delTCTGCCCAGGTTAAGGGCCACGGC	p.Ser53_Gly60del	conservative_inframe_deletion	Exon 2 of 3	ENST00000320868.9	NP_000549.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HBA1	ENST00000320868.9	c.157_180delTCTGCCCAGGTTAAGGGCCACGGC	p.Ser53_Gly60del	conservative_inframe_deletion	Exon 2 of 3	1	NM_000558.5	ENSP00000322421.5

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

Significance: other

Submissions summary: Other:1

Revision: no assertion criteria provided

Submissions by phenotype

HEMOGLOBIN J (BISKRA) Other:1

Jul 20, 2016

OMIM

Significance: other

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.2
Mutation Taster		=13/187	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs63750122; hg19: chr16-226980;