rs727504478

Variant names:

• chr5-156327123-GGGCCTGCACACACTCAGCGGGCCGAGT-G
• rs727504478
• ENST00000435422.7:c.-105_-79delTGCACACACTCAGCGGGCCGAGTGGCC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BS1_Supporting

The ENST00000435422.7(SGCD):​c.-105_-79delTGCACACACTCAGCGGGCCGAGTGGCC variant causes a 5 prime UTR change. The variant allele was found at a frequency of 0.000728 in 152,388 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency:
  • Genomes: 𝑓 0.00073 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: SGCD ENST00000435422.7 5_prime_UTR
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 6.75
• Publications: 0 publications found

Genes affected

SGCD (HGNC:10807): (sarcoglycan delta) The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]

SGCD Gene-Disease associations (from GenCC):

• autosomal recessive limb-girdle muscular dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• autosomal recessive limb-girdle muscular dystrophy type 2F

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Myriad Women’s Health, Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• dilated cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• dilated cardiomyopathy 1L

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics

LOC124901120 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.000728 (111/152388) while in subpopulation NFE AF = 0.00132 (90/68040). AF 95% confidence interval is 0.0011. There are 0 homozygotes in GnomAd4. There are 42 alleles in the male GnomAd4 subpopulation. Median coverage is 33. This position passed quality control check. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000435422.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SGCD	NM_000337.6	MANE Select	c.-152_-126delGGCCTGCACACACTCAGCGGGCCGAGT		upstream_gene	N/A	NP_000328.2
	SGCD	NM_001128209.2		c.-109_-83delGGCCTGCACACACTCAGCGGGCCGAGT		upstream_gene	N/A	NP_001121681.1	Q92629-1
	SGCD	NM_172244.3		c.-152_-126delGGCCTGCACACACTCAGCGGGCCGAGT		upstream_gene	N/A	NP_758447.1	Q92629-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SGCD	ENST00000435422.7	TSL:1	c.-105_-79delTGCACACACTCAGCGGGCCGAGTGGCC		5_prime_UTR	Exon 1 of 8	ENSP00000403003.2	Q92629-1
	SGCD	ENST00000959784.1		c.-148_-122delTGCACACACTCAGCGGGCCGAGTGGCC		5_prime_UTR	Exon 1 of 10	ENSP00000629843.1
	SGCD	ENST00000959783.1		c.-146_-120delTGCACACACTCAGCGGGCCGAGTGGCC		5_prime_UTR	Exon 1 of 9	ENSP00000629842.1

Frequencies

GnomAD3 genomes AF: 0.000729 AC: 111 AN: 152270 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.000458

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000131

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00132

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0 AN: 92 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 62

African (AFR) AC: 0 AN: 0

American (AMR) AC: 0 AN: 0

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 4

East Asian (EAS) AF: 0.00 AC: 0 AN: 2

South Asian (SAS) AC: 0 AN: 0

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68

Other (OTH) AF: 0.00 AC: 0 AN: 10

GnomAD4 genome AF: 0.000728 AC: 111 AN: 152388 Hom.: 0 Cov.: 33 AF XY: 0.000564 AC XY: 42 AN XY: 74528

African (AFR) AF: 0.000457 AC: 19 AN: 41600

American (AMR) AF: 0.000131 AC: 2 AN: 15314

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5180

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10630

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00132 AC: 90 AN: 68040

Other (OTH) AF: 0.00 AC: 0 AN: 2116

Alfa AF: 0.00160 Hom.: 0

Bravo AF: 0.000672

ClinVar

ClinVar submissions as Germline

Significance: not provided

Revision: no classification provided

Pathogenic	VUS	Benign	Condition
-	-	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727504478; hg19: chr5-155754133;