rs74315156

Variant names:

• chr16-16202056-AGCCTGTACATGTTCTGCTGCTCAAACAGCGTTT-A
• rs387906353
• NM_001171.6:c.1088_1120delAAACGCTGTTTGAGCAGCAGAACATGTACAGGC

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_001171.6(ABCC6):​c.1088_1120delAAACGCTGTTTGAGCAGCAGAACATGTACAGGC​(p.Gln363_Arg373del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ABCC6 NM_001171.6 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: 8.52
• Publications: 1 publications found

Genes affected

ABCC6 (HGNC:57): (ATP binding cassette subfamily C member 6) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]

ABCC6 Gene-Disease associations (from GenCC):

• arterial calcification, generalized, of infancy, 2

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• autosomal recessive inherited pseudoxanthoma elasticum

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Laboratory for Molecular Medicine, Orphanet
• inherited pseudoxanthoma elasticum

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• arterial calcification of infancy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 6 uncertain in NM_001171.6
• PM4: Nonframeshift variant in NON repetitive region in NM_001171.6.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 16-16202056-AGCCTGTACATGTTCTGCTGCTCAAACAGCGTTT-A is Pathogenic according to our data. Variant chr16-16202056-AGCCTGTACATGTTCTGCTGCTCAAACAGCGTTT-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 433408.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001171.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCC6	NM_001171.6	MANE Select	c.1088_1120delAAACGCTGTTTGAGCAGCAGAACATGTACAGGC	p.Gln363_Arg373del	disruptive_inframe_deletion	Exon 9 of 31	NP_001162.5
	ABCC6	NM_001440309.1		c.1088_1120delAAACGCTGTTTGAGCAGCAGAACATGTACAGGC	p.Gln363_Arg373del	disruptive_inframe_deletion	Exon 9 of 31	NP_001427238.1
	ABCC6	NM_001440310.1		c.1088_1120delAAACGCTGTTTGAGCAGCAGAACATGTACAGGC	p.Gln363_Arg373del	disruptive_inframe_deletion	Exon 9 of 30	NP_001427239.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCC6	ENST00000205557.12	TSL:1 MANE Select	c.1088_1120delAAACGCTGTTTGAGCAGCAGAACATGTACAGGC	p.Gln363_Arg373del	disruptive_inframe_deletion	Exon 9 of 31	ENSP00000205557.7	O95255-1
	ABCC6	ENST00000909083.1		c.1088_1120delAAACGCTGTTTGAGCAGCAGAACATGTACAGGC	p.Gln363_Arg373del	disruptive_inframe_deletion	Exon 9 of 32	ENSP00000579142.1
	ABCC6	ENST00000909090.1		c.1088_1120delAAACGCTGTTTGAGCAGCAGAACATGTACAGGC	p.Gln363_Arg373del	disruptive_inframe_deletion	Exon 9 of 32	ENSP00000579149.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 6.84e-7 AC: 1 AN: 1461670 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727144

African (AFR) AF: 0.00 AC: 0 AN: 33472

American (AMR) AF: 0.00 AC: 0 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86248

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5762

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111842

Other (OTH) AF: 0.0000166 AC: 1 AN: 60378

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
2	-	-	Autosomal recessive inherited pseudoxanthoma elasticum (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.5
Mutation Taster		=18/182	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs387906353; hg19: chr16-16295913;