rs760398606

Variant names:

• chr22-28703576-G-GGGGGAGAAAAAAGGGAAAGT
• rs760398606
• NM_007194.4:c.847-30_847-11dupACTTTCCCTTTTTTCTCCCC

Variant summary

Our verdict is Benign. The variant received -9 ACMG points: 0P and 9B. BP6_Very_Strong BS2_Supporting

The NM_007194.4(CHEK2):​c.847-30_847-11dupACTTTCCCTTTTTTCTCCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000149 in 1,543,114 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000015 (0 hom.)
• Consequence: CHEK2 NM_007194.4 intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: -0.839
• Publications: 0 publications found

Genes affected

CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

CHEK2 Gene-Disease associations (from GenCC):

• CHEK2-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics, ClinGen
• Li-Fraumeni syndrome 2

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• hereditary breast carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• acute myeloid leukemia

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary nonpolyposis colon cancer

  Inheritance: Unknown Classification: LIMITED Submitted by: ClinGen
• familial ovarian cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -9 ACMG points.

• BP6: Variant 22-28703576-G-GGGGGAGAAAAAAGGGAAAGT is Benign according to our data. Variant chr22-28703576-G-GGGGGAGAAAAAAGGGAAAGT is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 491646.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High AC in GnomAdExome4 at 21 AD gene. Variant has AC lower than other variant known as pathogenic in the gene, so the strength is limited to Supporting.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007194.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHEK2	NM_007194.4	MANE Select	c.847-30_847-11dupACTTTCCCTTTTTTCTCCCC		intron	N/A	NP_009125.1	O96017-1
	CHEK2	NM_001005735.3		c.976-30_976-11dupACTTTCCCTTTTTTCTCCCC		intron	N/A	NP_001005735.1
	CHEK2	NM_001438293.1		c.940-30_940-11dupACTTTCCCTTTTTTCTCCCC		intron	N/A	NP_001425222.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHEK2	ENST00000404276.6	TSL:1 MANE Select	c.847-11_847-10insACTTTCCCTTTTTTCTCCCC		intron	N/A	ENSP00000385747.1	O96017-1
	CHEK2	ENST00000382580.6	TSL:1	c.976-11_976-10insACTTTCCCTTTTTTCTCCCC		intron	N/A	ENSP00000372023.2	O96017-9
	CHEK2	ENST00000402731.6	TSL:1	c.646-11_646-10insACTTTCCCTTTTTTCTCCCC		intron	N/A	ENSP00000384835.2	A0A7P0MUT5

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152142 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000414

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000320 AC: 7 AN: 218892 AF XY: 0.0000339

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000151 AC: 21 AN: 1390854 Hom.: 0 Cov.: 24 AF XY: 0.0000202 AC XY: 14 AN XY: 693094

African (AFR) AF: 0.00 AC: 0 AN: 32056

American (AMR) AF: 0.00 AC: 0 AN: 41296

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25334

East Asian (EAS) AF: 0.00 AC: 0 AN: 39180

South Asian (SAS) AF: 0.000242 AC: 20 AN: 82574

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52206

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5668

European-Non Finnish (NFE) AF: 9.48e-7 AC: 1 AN: 1054580

Other (OTH) AF: 0.00 AC: 0 AN: 57960

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152260 Hom.: 0 Cov.: 31 AF XY: 0.0000134 AC XY: 1 AN XY: 74456

African (AFR) AF: 0.00 AC: 0 AN: 41550

American (AMR) AF: 0.00 AC: 0 AN: 15282

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5186

South Asian (SAS) AF: 0.000414 AC: 2 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 68016

Other (OTH) AF: 0.00 AC: 0 AN: 2112

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	Familial cancer of breast (2)
-	-	1	CHEK2-related cancer predisposition (1)
-	-	1	Hereditary cancer-predisposing syndrome (1)
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.84

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs760398606; hg19: chr22-29099564;