rs779483683

Variant names:

• chr3-123700312-ATTGCCCATGGGCTTCAGGGTCTCGGCAGGCTTGGCG-A
• rs779483683
• NM_053025.4:c.3120_3155delCGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAA

Your query was ambiguous. Multiple possible variants found:

• chr3-123700312-ATTGCCCATGGGCTTCAGGGTCTCGGCAGGCTTGGCG-A
• chr3-123700312-ATTGCCCATGGGCTTCAGGGTCTCGGCAGGCTTGGCG-ATTGCCCATGGGCTTCAGGGTCTCGGCAGGCTTGGCGTTGCCCATGGGCTTCAGGGTCTCGGCAGGCTTGGCG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_053025.4(MYLK):​c.3120_3155delCGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAA​(p.Ala1041_Asn1052del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000041 in 1,461,754 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. N1040N) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 30)
  • Exomes 𝑓: 0.0000041 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MYLK NM_053025.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 3.24
• Publications: 0 publications found

Genes affected

MYLK (HGNC:7590): (myosin light chain kinase) This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]

MYLK-AS1 (HGNC:42440): (MYLK antisense RNA 1)

LOC105369194 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_053025.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_053025.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYLK	NM_053025.4	MANE Select	c.3120_3155delCGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAA	p.Ala1041_Asn1052del	disruptive_inframe_deletion	Exon 18 of 34	NP_444253.3
	MYLK	NM_053027.4		c.3120_3155delCGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAA	p.Ala1041_Asn1052del	disruptive_inframe_deletion	Exon 18 of 33	NP_444255.3
	MYLK	NM_053026.4		c.2913_2948delCGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAA	p.Ala972_Asn983del	disruptive_inframe_deletion	Exon 17 of 33	NP_444254.3

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYLK	ENST00000360304.8	TSL:5 MANE Select	c.3120_3155delCGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAA	p.Ala1041_Asn1052del	disruptive_inframe_deletion	Exon 18 of 34	ENSP00000353452.3
	MYLK	ENST00000504946.6	TSL:1	c.729_764delCGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAA	p.Ala244_Asn255del	disruptive_inframe_deletion	Exon 2 of 4	ENSP00000510315.1
	MYLK	ENST00000464489.5	TSL:1	n.*2699_*2734delCGCCAAGCCTGCCGAGACCCTGAAGCCCATGGGCAA		non_coding_transcript_exon	Exon 17 of 33	ENSP00000417798.1

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 151696 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000795 AC: 2 AN: 251460 AF XY: 0.00

Gnomad AFR exome AF: 0.0000615

Gnomad AMR exome AF: 0.0000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000410 AC: 6 AN: 1461754 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727162

African (AFR) AF: 0.0000299 AC: 1 AN: 33478

American (AMR) AF: 0.0000447 AC: 2 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39692

South Asian (SAS) AF: 0.00 AC: 0 AN: 86230

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53420

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000270 AC: 3 AN: 1111924

Other (OTH) AF: 0.00 AC: 0 AN: 60386

GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 151696 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 74054

African (AFR) AF: 0.00 AC: 0 AN: 41252

American (AMR) AF: 0.00 AC: 0 AN: 15256

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5158

South Asian (SAS) AF: 0.00 AC: 0 AN: 4770

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10560

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67918

Other (OTH) AF: 0.00 AC: 0 AN: 2088

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Aortic aneurysm, familial thoracic 7 (1)
-	1	-	Familial thoracic aortic aneurysm and aortic dissection (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=138/62	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs779483683; hg19: chr3-123419159;