rs781992710
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 5P and 4B. PVS1_StrongPP5BS2
The NM_001004311.3(FIGLA):c.15_36delCGGCGTCCTAGATCCCCGCGCC(p.Gly6ArgfsTer66) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000121 in 1,317,352 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_001004311.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- premature ovarian failure 6Inheritance: AD, Unknown Classification: MODERATE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001004311.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FIGLA | NM_001004311.3 | MANE Select | c.15_36delCGGCGTCCTAGATCCCCGCGCC | p.Gly6ArgfsTer66 | frameshift | Exon 1 of 5 | NP_001004311.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FIGLA | ENST00000332372.6 | TSL:1 MANE Select | c.15_36delCGGCGTCCTAGATCCCCGCGCC | p.Gly6ArgfsTer66 | frameshift | Exon 1 of 5 | ENSP00000333097.6 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD2 exomes AF: 0.0000136 AC: 1AN: 73466 AF XY: 0.00 show subpopulations
GnomAD4 exome AF: 0.0000121 AC: 16AN: 1317352Hom.: 0 AF XY: 0.0000124 AC XY: 8AN XY: 646388 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at