rs786204964
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001323289.2(CDKL5):c.1008_1029delGTCTCACCACAGATCTAACAGC(p.Ser337ArgfsTer6) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay. The gene CDKL5 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_001323289.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- CDKL5 disorderInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- developmental and epileptic encephalopathy, 2Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- genetic developmental and epileptic encephalopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- infantile spasmsInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- precocious pubertyInheritance: XL Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001323289.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKL5 | MANE Select | c.1008_1029delGTCTCACCACAGATCTAACAGC | p.Ser337ArgfsTer6 | frameshift | Exon 12 of 18 | NP_001310218.1 | O76039-2 | ||
| CDKL5 | c.1008_1029delGTCTCACCACAGATCTAACAGC | p.Ser337ArgfsTer6 | frameshift | Exon 13 of 22 | NP_001032420.1 | O76039-1 | |||
| CDKL5 | c.1008_1029delGTCTCACCACAGATCTAACAGC | p.Ser337ArgfsTer6 | frameshift | Exon 12 of 21 | NP_003150.1 | O76039-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKL5 | TSL:1 MANE Select | c.1008_1029delGTCTCACCACAGATCTAACAGC | p.Ser337ArgfsTer6 | frameshift | Exon 12 of 18 | ENSP00000485244.1 | O76039-2 | ||
| CDKL5 | TSL:1 | c.1008_1029delGTCTCACCACAGATCTAACAGC | p.Ser337ArgfsTer6 | frameshift | Exon 13 of 22 | ENSP00000369325.3 | O76039-1 | ||
| CDKL5 | TSL:1 | c.1008_1029delGTCTCACCACAGATCTAACAGC | p.Ser337ArgfsTer6 | frameshift | Exon 12 of 21 | ENSP00000369332.3 | O76039-1 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.