rs79071878

Variant names:

• chr5-132680651-AATGAAGCAAGATGGCCTGTTGGGAGGCTACCACAGTAAACCAGGCTAGAGACGATGGTGGCGTGGACAGAATGAAGCAAGATGGCCTGTTGGGAGGCTACCACAGTAAACCAGGCTAGAGATGATGGTGGCGTGGACAGAAT-A
• rs79071878
• NM_000589.4:c.360+762_360+903del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000589.4(IL4):​c.360+762_360+903del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 31)
• Consequence: IL4 NM_000589.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.752
• Publications: 21 publications found

Genes affected

IL4 (HGNC:6014): (interleukin 4) The protein encoded by this gene is a pleiotropic cytokine produced by activated T cells. This cytokine is a ligand for interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to many overlapping functions of this cytokine and IL13. STAT6, a signal transducer and activator of transcription, has been shown to play a central role in mediating the immune regulatory signal of this cytokine. This gene, IL3, IL5, IL13, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL13. This gene, IL13 and IL5 are found to be regulated coordinately by several long-range regulatory elements in an over 120 kilobase range on the chromosome. IL4 is considered an important cytokine for tissue repair, counterbalancing the effects of proinflammatory type 1 cytokines, however, it also promotes allergic airway inflammation. Moreover, IL-4, a type 2 cytokine, mediates and regulates a variety of human host responses such as allergic, anti-parasitic, wound healing, and acute inflammation. This cytokine has been reported to promote resolution of neutrophil-mediated acute lung injury. In an allergic response, IL-4 has an essential role in the production of allergen-specific immunoglobin (Ig) E. This pro-inflammatory cytokine has been observed to be increased in COVID-19 (Coronavirus disease 2019) patients, but is not necessarily associated with severe COVID-19 pathology. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]

LOC105379176 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000589.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IL4	NM_000589.4	MANE Select	c.360+762_360+903del		intron	N/A	NP_000580.1	P05112-1
	IL4	NM_172348.3		c.312+762_312+903del		intron	N/A	NP_758858.1	Q5FC01
	IL4	NM_001354990.2		c.*50+762_*50+903del		intron	N/A	NP_001341919.1	U3LVN1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IL4	ENST00000231449.7	TSL:1 MANE Select	c.360+762_360+903del		intron	N/A	ENSP00000231449.2	P05112-1
	IL4	ENST00000350025.2	TSL:1	c.312+762_312+903del		intron	N/A	ENSP00000325190.3	P05112-2
	IL4	ENST00000622422.1	TSL:1	c.*50+762_*50+903del		intron	N/A	ENSP00000480581.1	U3LVN1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.75

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs79071878; hg19: chr5-132016343;