rs797045671
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_003482.4(KMT2D):c.8445_8475dupACAACTGTGGCAGCAACAACAGGCAACAGCA(p.Ala2826ThrfsTer29) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_003482.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- choanal atresia-athelia-hypothyroidism-delayed puberty-short stature syndromeInheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: Illumina, G2P
- Kabuki syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Laboratory for Molecular Medicine, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics
- branchial arch abnormalities, choanal atresia, athelia, hearing loss, and hypothyroidism syndromeInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Kabuki syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003482.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KMT2D | NM_003482.4 | MANE Select | c.8445_8475dupACAACTGTGGCAGCAACAACAGGCAACAGCA | p.Ala2826ThrfsTer29 | frameshift | Exon 35 of 55 | NP_003473.3 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KMT2D | ENST00000301067.12 | TSL:5 MANE Select | c.8445_8475dupACAACTGTGGCAGCAACAACAGGCAACAGCA | p.Ala2826ThrfsTer29 | frameshift | Exon 35 of 55 | ENSP00000301067.7 | ||
| KMT2D | ENST00000683543.2 | c.8445_8475dupACAACTGTGGCAGCAACAACAGGCAACAGCA | p.Ala2826ThrfsTer29 | frameshift | Exon 35 of 56 | ENSP00000506726.1 | |||
| KMT2D | ENST00000685166.1 | c.8454_8484dupACAACTGTGGCAGCAACAACAGGCAACAGCA | p.Ala2829ThrfsTer29 | frameshift | Exon 34 of 54 | ENSP00000509386.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at