rs797045954
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_ModeratePP5_Very_Strong
The NM_005850.5(SF3B4):c.1230_1249delACCAGTTCCCCCTCGAGGCC(p.Pro411ThrfsTer68) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_005850.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- Nager acrofacial dysostosisInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- SF3B4-related acrofacial dysostosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- acrofacial dysostosis Rodriguez typeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005850.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SF3B4 | TSL:1 MANE Select | c.1230_1249delACCAGTTCCCCCTCGAGGCC | p.Pro411ThrfsTer68 | frameshift | Exon 6 of 6 | ENSP00000271628.8 | Q15427 | ||
| SF3B4 | c.921_940delACCAGTTCCCCCTCGAGGCC | p.Pro308ThrfsTer68 | frameshift | Exon 6 of 6 | ENSP00000610823.1 | ||||
| SF3B4 | c.759_778delACCAGTTCCCCCTCGAGGCC | p.Pro254ThrfsTer68 | frameshift | Exon 6 of 6 | ENSP00000610824.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at