rs797045954

Variant names:

• chr1-149923567-GGGCCTCGAGGGGGAACTGGT-G
• rs797045954
• NM_005850.5:c.1230_1249delACCAGTTCCCCCTCGAGGCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_Moderate PP5_Very_Strong

The NM_005850.5(SF3B4):​c.1230_1249delACCAGTTCCCCCTCGAGGCC​(p.Pro411ThrfsTer68) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SF3B4 NM_005850.5 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 8.05
• Publications: 1 publications found

Genes affected

SF3B4 (HGNC:10771): (splicing factor 3b subunit 4) This gene encodes one of four subunits of the splicing factor 3B. The protein encoded by this gene cross-links to a region in the pre-mRNA immediately upstream of the branchpoint sequence in pre-mRNA in the prespliceosomal complex A. It also may be involved in the assembly of the B, C and E spliceosomal complexes. In addition to RNA-binding activity, this protein interacts directly and highly specifically with subunit 2 of the splicing factor 3B. This protein contains two N-terminal RNA-recognition motifs (RRMs), consistent with the observation that it binds directly to pre-mRNA. [provided by RefSeq, Jul 2008]

SF3B4 Gene-Disease associations (from GenCC):

• Nager acrofacial dysostosis

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• SF3B4-related acrofacial dysostosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• acrofacial dysostosis Rodriguez type

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0353 CDS is truncated, and there are 3 pathogenic variants in the truncated region.
• PP5: Variant 1-149923567-GGGCCTCGAGGGGGAACTGGT-G is Pathogenic according to our data. Variant chr1-149923567-GGGCCTCGAGGGGGAACTGGT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 212156.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005850.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SF3B4	NM_005850.5	MANE Select	c.1230_1249delACCAGTTCCCCCTCGAGGCC	p.Pro411ThrfsTer68	frameshift	Exon 6 of 6	NP_005841.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SF3B4	ENST00000271628.9	TSL:1 MANE Select	c.1230_1249delACCAGTTCCCCCTCGAGGCC	p.Pro411ThrfsTer68	frameshift	Exon 6 of 6	ENSP00000271628.8
	SF3B4	ENST00000940764.1		c.921_940delACCAGTTCCCCCTCGAGGCC	p.Pro308ThrfsTer68	frameshift	Exon 6 of 6	ENSP00000610823.1
	SF3B4	ENST00000940765.1		c.759_778delACCAGTTCCCCCTCGAGGCC	p.Pro254ThrfsTer68	frameshift	Exon 6 of 6	ENSP00000610824.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Nager syndrome (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.0
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs797045954; hg19: chr1-149895459;