rs864622092

Variant names:

• chr2-47369542-CTTGCCGCGGCGACGGCGACTT-C
• rs864622092
• NM_002354.3:c.45_65delGGCGACGGCGACTTTTGCCGC

Your query was ambiguous. Multiple possible variants found:

• chr2-47369542-CTTGCCGCGGCGACGGCGACTT-C
• chr2-47369542-CTTGCCGCGGCGACGGCGACTT-CTTGCCGCGGCGACGGCGACTTTTGCCGCGGCGACGGCGACTT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_002354.3(EPCAM):​c.45_65delGGCGACGGCGACTTTTGCCGC​(p.Ala16_Ala22del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000114 in 1,584,554 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A15A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000010 (0 hom.)
• Consequence: EPCAM NM_002354.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 3.44
• Publications: 1 publications found

Genes affected

EPCAM (HGNC:11529): (epithelial cell adhesion molecule) This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]

EPCAM Gene-Disease associations (from GenCC):

• Lynch syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• Lynch syndrome 8

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• congenital diarrhea 5 with tufting enteropathy

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Orphanet, G2P, Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_002354.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002354.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EPCAM	NM_002354.3	MANE Select	c.45_65delGGCGACGGCGACTTTTGCCGC	p.Ala16_Ala22del	disruptive_inframe_deletion	Exon 1 of 9	NP_002345.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EPCAM	ENST00000263735.9	TSL:1 MANE Select	c.45_65delGGCGACGGCGACTTTTGCCGC	p.Ala16_Ala22del	disruptive_inframe_deletion	Exon 1 of 9	ENSP00000263735.4
	EPCAM	ENST00000419334.1	TSL:3	c.45_65delGGCGACGGCGACTTTTGCCGC	p.Ala16_Ala22del	disruptive_inframe_deletion	Exon 1 of 3	ENSP00000389028.1
	EPCAM	ENST00000474691.1	TSL:5	n.76_96delGGCGACGGCGACTTTTGCCGC		non_coding_transcript_exon	Exon 1 of 3

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152160 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000483

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000105 AC: 15 AN: 1432394 Hom.: 0 AF XY: 0.0000141 AC XY: 10 AN XY: 710430

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32460

American (AMR) AF: 0.00 AC: 0 AN: 40186

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25398

East Asian (EAS) AF: 0.00 AC: 0 AN: 38418

South Asian (SAS) AF: 0.00 AC: 0 AN: 81824

European-Finnish (FIN) AF: 0.0000207 AC: 1 AN: 48342

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4578

European-Non Finnish (NFE) AF: 0.0000127 AC: 14 AN: 1101870

Other (OTH) AF: 0.00 AC: 0 AN: 59318

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000138635), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152160 Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3 AN XY: 74328

African (AFR) AF: 0.0000483 AC: 2 AN: 41450

American (AMR) AF: 0.00 AC: 0 AN: 15286

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5154

South Asian (SAS) AF: 0.00 AC: 0 AN: 4838

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10622

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68022

Other (OTH) AF: 0.00 AC: 0 AN: 2094

Alfa AF: 0.000142 Hom.: 0

Bravo AF: 0.0000189

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary nonpolyposis colorectal neoplasms (1)
-	1	-	Lynch syndrome (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.4
Mutation Taster		=146/54	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs864622092; hg19: chr2-47596681;