rs879254577

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000527.5(LDLR):​c.568_590delTTCCAAGGGGACAGTAGCCCCTG​(p.Phe190LeufsTer20) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

LDLR
NM_000527.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 0.259
Variant links:
Genes affected
LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 19-11105471-GTGTTCCAAGGGGACAGTAGCCCC-G is Pathogenic according to our data. Variant chr19-11105471-GTGTTCCAAGGGGACAGTAGCCCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 251301.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr19-11105471-GTGTTCCAAGGGGACAGTAGCCCC-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
LDLRNM_000527.5 linkc.568_590delTTCCAAGGGGACAGTAGCCCCTG p.Phe190LeufsTer20 frameshift_variant Exon 4 of 18 ENST00000558518.6 NP_000518.1 P01130-1A0A024R7D5

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
LDLRENST00000558518.6 linkc.568_590delTTCCAAGGGGACAGTAGCCCCTG p.Phe190LeufsTer20 frameshift_variant Exon 4 of 18 1 NM_000527.5 ENSP00000454071.1 P01130-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:1
Mar 25, 2016
LDLR-LOVD, British Heart Foundation
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: literature only

- -

Familial hypercholesterolemia Pathogenic:1
Jun 25, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

ClinVar contains an entry for this variant (Variation ID: 251301). This sequence change creates a premature translational stop signal (p.Phe190Leufs*20) in the LDLR gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in LDLR are known to be pathogenic (PMID: 20809525, 28645073). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with autosomal dominant familial hypercholesterolemia (PMID: 7557960). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs879254577; hg19: chr19-11216147; API