FRA16B
biological-regionfragile site, distamycin A type, rare, fra(16)(q22.1)
Gene summary
This biological region is found within an intron of the long intergenic non-protein coding RNA 922 gene on the p arm of chromosome 16. This region is a distamycin A-sensitive fragile site that contains a 33 nt AT-rich minisatellite repeat with a consensus sequence of ATATATTATATATTATATCTAATAATATATC/ATA. Fragility at this site is induced by AT base pair-specific non-intercalative DNA ligands such as distamycin A, berenil and bromodeoxyuridine. This region is highly polymorphic, with most individuals of European descent containing about 7 to 12 copies of the repeat. Expansion of the 33 nt repeat to copy numbers up to about 2000 is observed in about 5% of individuals of European descent, disrupts nucleosomal formation in the presence of distamycin A, results in delayed DNA replication at this site, forms secondary structures in vitro, and is a cause of fragility. Expanded repeats are thought to display both somatic and germline instability. [provided by RefSeq, Jan 2017]
MANE transcript
Inheritance
ClinVar variants
Top phenotype
Max pathogenic AF
External References & Databases
GenCC Phenotypes & Disease Associations
Curated gene-disease validity assertions and inheritance patterns
No GenCC data available for this gene.
ClinVar Associated Diseases & Phenotypes
Reported disease conditions connected to FRA16B variants in ClinVar
No annotated ClinVar phenotypes.
ClinVar Variants & Pathogenicity by Type
Statistics based on transcript . Only rare variants are included.
We include only reliable ClinVar variants with their consequences to MANE Select, MANE Plus Clinical transcripts, or transcripts with TSL equal to 1. Click a count to filter the variants table below.
Slight differences between displayed counts and ClinVar may occur due to a different transcript/consequence chosen by our variant effect predictor, or because we classify Benign/Likely benign as Likely benign and Pathogenic/Likely pathogenic as Likely pathogenic.
| Effect | PathogenicP | Likely pathogenicLP | VUS | Likely benignLB | BenignB | Sum |
|---|---|---|---|---|---|---|
| synonymous | 0 | |||||
| missense | 0 | |||||
| nonsense | 0 | |||||
| start loss | 0 | |||||
| frameshift | 0 | |||||
| splice donor/acceptor (+/-2bp) | 0 | |||||
| Total | 0 | 0 | 0 | 0 | 0 | 0 |
Transcript Catalog
Annotated transcript isoforms across RefSeq and Ensembl databases
| Transcript ID | Source | Protein ID | Coding Exons | MANE Status |
|---|---|---|---|---|
| No transcripts match your selected source or search query. | ||||