← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 1-229431916-CGGGGAGCGTGAGCAGAAGCTC-GGGGGGAGCGTGAGCAGAAGCT (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=1&pos=229431916&ref=CGGGGAGCGTGAGCAGAAGCTC&alt=GGGGGGAGCGTGAGCAGAAGCT&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "1",
"pos": 229431916,
"ref": "CGGGGAGCGTGAGCAGAAGCTC",
"alt": "GGGGGGAGCGTGAGCAGAAGCT",
"effect": "intron_variant",
"transcript": "NM_001100.4",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "NM_001100.4",
"protein_id": "NP_001091.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 377,
"cds_start": null,
"cds_end": null,
"cds_length": 1134,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000366684.7",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001100.4"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000366684.7",
"protein_id": "ENSP00000355645.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 377,
"cds_start": null,
"cds_end": null,
"cds_length": 1134,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "NM_001100.4",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000366684.7"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000871224.1",
"protein_id": "ENSP00000541283.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 377,
"cds_start": null,
"cds_end": null,
"cds_length": 1134,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000871224.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000871225.1",
"protein_id": "ENSP00000541284.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 377,
"cds_start": null,
"cds_end": null,
"cds_length": 1134,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000871225.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000871228.1",
"protein_id": "ENSP00000541287.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 377,
"cds_start": null,
"cds_end": null,
"cds_length": 1134,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000871228.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000947079.1",
"protein_id": "ENSP00000617138.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 377,
"cds_start": null,
"cds_end": null,
"cds_length": 1134,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000947079.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000947080.1",
"protein_id": "ENSP00000617139.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 377,
"cds_start": null,
"cds_end": null,
"cds_length": 1134,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000947080.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000947081.1",
"protein_id": "ENSP00000617140.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 377,
"cds_start": null,
"cds_end": null,
"cds_length": 1134,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000947081.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000871227.1",
"protein_id": "ENSP00000541286.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 352,
"cds_start": null,
"cds_end": null,
"cds_length": 1059,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000871227.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000366683.4",
"protein_id": "ENSP00000355644.4",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 351,
"cds_start": null,
"cds_end": null,
"cds_length": 1056,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000366683.4"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.674-35_674-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000684723.1",
"protein_id": "ENSP00000508084.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 332,
"cds_start": null,
"cds_end": null,
"cds_length": 999,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000684723.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"hgvs_c": "c.647-35_647-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null,
"transcript": "ENST00000871226.1",
"protein_id": "ENSP00000541285.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 323,
"cds_start": null,
"cds_end": null,
"cds_length": 972,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000871226.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 1,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ENSG00000290037",
"gene_hgnc_id": null,
"hgvs_c": "n.*55_*76delCGGGGAGCGTGAGCAGAAGCTCinsGGGGGGAGCGTGAGCAGAAGCT",
"hgvs_p": null,
"transcript": "ENST00000702606.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000702606.2"
}
],
"gene_symbol": "ACTA1",
"gene_hgnc_id": 129,
"dbsnp": "rs1553255366",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.611,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -2,
"acmg_classification": "Likely_benign",
"acmg_criteria": "BP6_Moderate",
"acmg_by_gene": [
{
"score": -2,
"benign_score": 2,
"pathogenic_score": 0,
"criteria": [
"BP6_Moderate"
],
"verdict": "Likely_benign",
"transcript": "NM_001100.4",
"gene_symbol": "ACTA1",
"hgnc_id": 129,
"effects": [
"intron_variant"
],
"inheritance_mode": "SD,AD,AR,Unknown",
"hgvs_c": "c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC",
"hgvs_p": null
},
{
"score": -2,
"benign_score": 2,
"pathogenic_score": 0,
"criteria": [
"BP6_Moderate"
],
"verdict": "Likely_benign",
"transcript": "ENST00000702606.2",
"gene_symbol": "ENSG00000290037",
"hgnc_id": null,
"effects": [
"downstream_gene_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.*55_*76delCGGGGAGCGTGAGCAGAAGCTCinsGGGGGGAGCGTGAGCAGAAGCT",
"hgvs_p": null
}
],
"clinvar_disease": "not specified",
"clinvar_classification": "Benign",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "B:1",
"phenotype_combined": "not specified",
"pathogenicity_classification_combined": "Benign",
"custom_annotations": null
}
],
"message": null
}