← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 10-71397276-C-CCGAGGCGAGGCGAGGCGAGG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=10&pos=71397276&ref=C&alt=CCGAGGCGAGGCGAGGCGAGG&genome=hg38&allGenes=true"
API Response
json
{
"variants": [
{
"chr": "10",
"pos": 71397276,
"ref": "C",
"alt": "CCGAGGCGAGGCGAGGCGAGG",
"effect": "5_prime_UTR_variant",
"transcript": "NM_022124.6",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 70,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "NM_022124.6",
"protein_id": "NP_071407.4",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 3354,
"cds_start": -4,
"cds_end": null,
"cds_length": 10065,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11138,
"mane_select": "ENST00000224721.12",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 70,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "ENST00000224721.12",
"protein_id": "ENSP00000224721.9",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 3354,
"cds_start": -4,
"cds_end": null,
"cds_length": 10065,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11138,
"mane_select": "NM_022124.6",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "R",
"aa_alt": "RRGEARR?",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.105_106insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": "p.Arg38fs",
"transcript": "ENST00000644511.1",
"protein_id": "ENSP00000495691.1",
"transcript_support_level": null,
"aa_start": 36,
"aa_end": null,
"aa_length": 114,
"cds_start": 106,
"cds_end": null,
"cds_length": 346,
"cdna_start": 346,
"cdna_end": null,
"cdna_length": 586,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "NM_001171930.2",
"protein_id": "NP_001165401.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1381,
"cds_start": -4,
"cds_end": null,
"cds_length": 4146,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4858,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "ENST00000616684.4",
"protein_id": "ENSP00000482036.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1381,
"cds_start": -4,
"cds_end": null,
"cds_length": 4146,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4814,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "ENST00000398809.9",
"protein_id": "ENSP00000381789.5",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1380,
"cds_start": -4,
"cds_end": null,
"cds_length": 4143,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4839,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "NM_001171931.2",
"protein_id": "NP_001165402.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1061,
"cds_start": -4,
"cds_end": null,
"cds_length": 3186,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3971,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "ENST00000299366.11",
"protein_id": "ENSP00000299366.8",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 1061,
"cds_start": -4,
"cds_end": null,
"cds_length": 3186,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3954,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "NM_052836.4",
"protein_id": "NP_443068.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 530,
"cds_start": -4,
"cds_end": null,
"cds_length": 1593,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2698,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "ENST00000461841.7",
"protein_id": "ENSP00000473454.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 530,
"cds_start": -4,
"cds_end": null,
"cds_length": 1593,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2000,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null,
"transcript": "NM_001171932.2",
"protein_id": "NP_001165403.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 406,
"cds_start": -4,
"cds_end": null,
"cds_length": 1221,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1750,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "CDH23",
"gene_hgnc_id": 13733,
"dbsnp": "rs71012280",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": -0.03,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "NM_022124.6",
"gene_symbol": "CDH23",
"hgnc_id": 13733,
"effects": [
"5_prime_UTR_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.-31_-30insAGGCGAGGCGAGGCGAGGCG",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}