← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 10-86899821-ACAATAGAATGTTGTCGGAC-A (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=10&pos=86899821&ref=ACAATAGAATGTTGTCGGAC&alt=A&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "10",
      "pos": 86899821,
      "ref": "ACAATAGAATGTTGTCGGAC",
      "alt": "A",
      "effect": "frameshift_variant",
      "transcript": "ENST00000372037.8",
      "consequences": [
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_004329.3",
          "protein_id": "NP_004320.2",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 934,
          "cdna_end": null,
          "cdna_length": 6417,
          "mane_select": "ENST00000372037.8",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "ENST00000372037.8",
          "protein_id": "ENSP00000361107.2",
          "transcript_support_level": 1,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 934,
          "cdna_end": null,
          "cdna_length": 6417,
          "mane_select": "NM_004329.3",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406559.1",
          "protein_id": "NP_001393488.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 557,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1674,
          "cdna_start": 934,
          "cdna_end": null,
          "cdna_length": 6492,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406560.1",
          "protein_id": "NP_001393489.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 548,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1647,
          "cdna_start": 934,
          "cdna_end": null,
          "cdna_length": 6465,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406561.1",
          "protein_id": "NP_001393490.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1039,
          "cdna_end": null,
          "cdna_length": 6522,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406562.1",
          "protein_id": "NP_001393491.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1080,
          "cdna_end": null,
          "cdna_length": 6563,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406563.1",
          "protein_id": "NP_001393492.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1331,
          "cdna_end": null,
          "cdna_length": 6814,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406564.1",
          "protein_id": "NP_001393493.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 939,
          "cdna_end": null,
          "cdna_length": 6422,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406565.1",
          "protein_id": "NP_001393494.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1194,
          "cdna_end": null,
          "cdna_length": 6677,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406566.1",
          "protein_id": "NP_001393495.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 834,
          "cdna_end": null,
          "cdna_length": 6317,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406567.1",
          "protein_id": "NP_001393496.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 860,
          "cdna_end": null,
          "cdna_length": 6343,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406568.1",
          "protein_id": "NP_001393497.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 975,
          "cdna_end": null,
          "cdna_length": 6458,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406569.1",
          "protein_id": "NP_001393498.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1248,
          "cdna_end": null,
          "cdna_length": 6731,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406570.1",
          "protein_id": "NP_001393499.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1063,
          "cdna_end": null,
          "cdna_length": 6546,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406571.1",
          "protein_id": "NP_001393500.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1353,
          "cdna_end": null,
          "cdna_length": 6836,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406572.1",
          "protein_id": "NP_001393501.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1283,
          "cdna_end": null,
          "cdna_length": 6766,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406573.1",
          "protein_id": "NP_001393502.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 965,
          "cdna_end": null,
          "cdna_length": 6448,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406574.1",
          "protein_id": "NP_001393503.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1009,
          "cdna_end": null,
          "cdna_length": 6492,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406575.1",
          "protein_id": "NP_001393504.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1138,
          "cdna_end": null,
          "cdna_length": 6621,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406576.1",
          "protein_id": "NP_001393505.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1141,
          "cdna_end": null,
          "cdna_length": 6624,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406577.1",
          "protein_id": "NP_001393506.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1253,
          "cdna_end": null,
          "cdna_length": 6736,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406578.1",
          "protein_id": "NP_001393507.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1226,
          "cdna_end": null,
          "cdna_length": 6709,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406579.1",
          "protein_id": "NP_001393508.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1334,
          "cdna_end": null,
          "cdna_length": 6817,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406580.1",
          "protein_id": "NP_001393509.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 983,
          "cdna_end": null,
          "cdna_length": 6466,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406581.1",
          "protein_id": "NP_001393510.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1167,
          "cdna_end": null,
          "cdna_length": 6650,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406582.1",
          "protein_id": "NP_001393511.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1178,
          "cdna_end": null,
          "cdna_length": 6661,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "ENST00000480152.3",
          "protein_id": "ENSP00000483569.2",
          "transcript_support_level": 3,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1008,
          "cdna_end": null,
          "cdna_length": 6347,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "ENST00000713672.1",
          "protein_id": "ENSP00000518974.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 818,
          "cdna_end": null,
          "cdna_length": 6157,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "ENST00000713675.1",
          "protein_id": "ENSP00000518977.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 1187,
          "cdna_end": null,
          "cdna_length": 3887,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "NM_001406583.1",
          "protein_id": "NP_001393512.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 530,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1593,
          "cdna_start": 934,
          "cdna_end": null,
          "cdna_length": 6411,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.282_300delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu95fs",
          "transcript": "NM_001406584.1",
          "protein_id": "NP_001393513.1",
          "transcript_support_level": null,
          "aa_start": 94,
          "aa_end": null,
          "aa_length": 504,
          "cds_start": 282,
          "cds_end": null,
          "cds_length": 1515,
          "cdna_start": 820,
          "cdna_end": null,
          "cdna_length": 6303,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.282_300delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu95fs",
          "transcript": "NM_001406585.1",
          "protein_id": "NP_001393514.1",
          "transcript_support_level": null,
          "aa_start": 94,
          "aa_end": null,
          "aa_length": 504,
          "cds_start": 282,
          "cds_end": null,
          "cds_length": 1515,
          "cdna_start": 600,
          "cdna_end": null,
          "cdna_length": 6083,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.282_300delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu95fs",
          "transcript": "NM_001406586.1",
          "protein_id": "NP_001393515.1",
          "transcript_support_level": null,
          "aa_start": 94,
          "aa_end": null,
          "aa_length": 504,
          "cds_start": 282,
          "cds_end": null,
          "cds_length": 1515,
          "cdna_start": 595,
          "cdna_end": null,
          "cdna_length": 6078,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.282_300delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu95fs",
          "transcript": "NM_001406587.1",
          "protein_id": "NP_001393516.1",
          "transcript_support_level": null,
          "aa_start": 94,
          "aa_end": null,
          "aa_length": 504,
          "cds_start": 282,
          "cds_end": null,
          "cds_length": 1515,
          "cdna_start": 715,
          "cdna_end": null,
          "cdna_length": 6198,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.282_300delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu95fs",
          "transcript": "NM_001406588.1",
          "protein_id": "NP_001393517.1",
          "transcript_support_level": null,
          "aa_start": 94,
          "aa_end": null,
          "aa_length": 504,
          "cds_start": 282,
          "cds_end": null,
          "cds_length": 1515,
          "cdna_start": 929,
          "cdna_end": null,
          "cdna_length": 6412,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "ENST00000713669.1",
          "protein_id": "ENSP00000518971.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 471,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1416,
          "cdna_start": 950,
          "cdna_end": null,
          "cdna_length": 3440,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 5,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.66_84delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu23fs",
          "transcript": "ENST00000713673.1",
          "protein_id": "ENSP00000518975.1",
          "transcript_support_level": null,
          "aa_start": 22,
          "aa_end": null,
          "aa_length": 432,
          "cds_start": 66,
          "cds_end": null,
          "cds_length": 1299,
          "cdna_start": 770,
          "cdna_end": null,
          "cdna_length": 6253,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "IECCRTN",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs",
          "transcript": "XM_047425680.1",
          "protein_id": "XP_047281636.1",
          "transcript_support_level": null,
          "aa_start": 122,
          "aa_end": null,
          "aa_length": 532,
          "cds_start": 366,
          "cds_end": null,
          "cds_length": 1599,
          "cdna_start": 25306,
          "cdna_end": null,
          "cdna_length": 30789,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "n.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "ENST00000635816.2",
          "protein_id": "ENSP00000489707.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4885,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "n.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "ENST00000636056.2",
          "protein_id": "ENSP00000490273.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3558,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "n.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "ENST00000638429.1",
          "protein_id": "ENSP00000492290.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5632,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "n.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "ENST00000713671.1",
          "protein_id": "ENSP00000518973.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6403,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "n.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "ENST00000713674.1",
          "protein_id": "ENSP00000518976.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3697,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "n.934_952delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "NR_176211.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3561,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "n.934_952delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "NR_176212.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3564,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "n.934_952delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "NR_176213.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5633,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.-112_-94delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "ENST00000713670.1",
          "protein_id": "ENSP00000518972.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 373,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1122,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6010,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 5,
          "intron_rank_end": null,
          "gene_symbol": "BMPR1A",
          "gene_hgnc_id": 1076,
          "hgvs_c": "c.333+7597_333+7615delAGAATGTTGTCGGACCAAT",
          "hgvs_p": null,
          "transcript": "NM_001406589.1",
          "protein_id": "NP_001393518.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 418,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 1257,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6075,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "BMPR1A",
      "gene_hgnc_id": 1076,
      "dbsnp": "rs1554888970",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 8.588,
      "phylop100way_prediction": "Pathogenic",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 10,
      "acmg_classification": "Pathogenic",
      "acmg_criteria": "PVS1,PP5_Moderate",
      "acmg_by_gene": [
        {
          "score": 10,
          "benign_score": 0,
          "pathogenic_score": 10,
          "criteria": [
            "PVS1",
            "PP5_Moderate"
          ],
          "verdict": "Pathogenic",
          "transcript": "ENST00000372037.8",
          "gene_symbol": "BMPR1A",
          "hgnc_id": 1076,
          "effects": [
            "frameshift_variant"
          ],
          "inheritance_mode": "AD,Unknown",
          "hgvs_c": "c.366_384delAGAATGTTGTCGGACCAAT",
          "hgvs_p": "p.Glu123fs"
        }
      ],
      "clinvar_disease": "Generalized juvenile polyposis/juvenile polyposis coli",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "P:1",
      "phenotype_combined": "Generalized juvenile polyposis/juvenile polyposis coli",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}