← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 11-108335940-ATTAACTATCTGTACTTATAAG-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=11&pos=108335940&ref=ATTAACTATCTGTACTTATAAG&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "11",
"pos": 108335940,
"ref": "ATTAACTATCTGTACTTATAAG",
"alt": "A",
"effect": "conservative_inframe_deletion,splice_region_variant",
"transcript": "ENST00000675843.1",
"consequences": [
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "NM_000051.4",
"protein_id": "NP_000042.3",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 8398,
"cdna_end": null,
"cdna_length": 12915,
"mane_select": "ENST00000675843.1",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "ENST00000675843.1",
"protein_id": "ENSP00000501606.1",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 8398,
"cdna_end": null,
"cdna_length": 12915,
"mane_select": "NM_000051.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 57,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "ENST00000452508.7",
"protein_id": "ENSP00000388058.2",
"transcript_support_level": 1,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 8730,
"cdna_end": null,
"cdna_length": 13247,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 54,
"exon_rank_end": null,
"exon_count": 61,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*3312_*3332delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000527805.6",
"protein_id": "ENSP00000435747.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 9287,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 54,
"exon_rank_end": null,
"exon_count": 61,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*3312_*3332delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000527805.6",
"protein_id": "ENSP00000435747.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 9287,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.*1197-669_*1197-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "ENST00000615746.4",
"protein_id": "ENSP00000483537.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 313,
"cds_start": -4,
"cds_end": null,
"cds_length": 942,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2711,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 57,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "NM_001351834.2",
"protein_id": "NP_001338763.1",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 8486,
"cdna_end": null,
"cdna_length": 13003,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "ENST00000278616.10",
"protein_id": "ENSP00000278616.4",
"transcript_support_level": 5,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 8554,
"cdna_end": null,
"cdna_length": 11233,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 57,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "ENST00000601453.3",
"protein_id": "ENSP00000469471.2",
"transcript_support_level": 3,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 9699,
"cdna_end": null,
"cdna_length": 14216,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 57,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "ENST00000713844.1",
"protein_id": "ENSP00000519149.1",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 8412,
"cdna_end": null,
"cdna_length": 9550,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "XM_005271562.6",
"protein_id": "XP_005271619.2",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 8640,
"cdna_end": null,
"cdna_length": 13157,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "XM_006718843.5",
"protein_id": "XP_006718906.1",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 9348,
"cdna_end": null,
"cdna_length": 13865,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 57,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "XM_011542840.4",
"protein_id": "XP_011541142.1",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 9436,
"cdna_end": null,
"cdna_length": 13953,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "XM_017017790.3",
"protein_id": "XP_016873279.1",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 9216,
"cdna_end": null,
"cdna_length": 13733,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 57,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "XM_047426975.1",
"protein_id": "XP_047282931.1",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 9189,
"cdna_end": null,
"cdna_length": 13706,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 57,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "XM_047426976.1",
"protein_id": "XP_047282932.1",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 3056,
"cds_start": 8248,
"cds_end": null,
"cds_length": 9171,
"cdna_start": 8728,
"cdna_end": null,
"cdna_length": 13245,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 55,
"exon_rank_end": null,
"exon_count": 62,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8083_8103delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2695_Lys2701del",
"transcript": "XM_011542842.4",
"protein_id": "XP_011541144.1",
"transcript_support_level": null,
"aa_start": 2695,
"aa_end": null,
"aa_length": 3001,
"cds_start": 8083,
"cds_end": null,
"cds_length": 9006,
"cdna_start": 8233,
"cdna_end": null,
"cdna_length": 12750,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8083_8103delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2695_Lys2701del",
"transcript": "XM_047426977.1",
"protein_id": "XP_047282933.1",
"transcript_support_level": null,
"aa_start": 2695,
"aa_end": null,
"aa_length": 3001,
"cds_start": 8083,
"cds_end": null,
"cds_length": 9006,
"cdna_start": 9271,
"cdna_end": null,
"cdna_length": 13788,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8083_8103delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2695_Lys2701del",
"transcript": "XM_047426978.1",
"protein_id": "XP_047282934.1",
"transcript_support_level": null,
"aa_start": 2695,
"aa_end": null,
"aa_length": 3001,
"cds_start": 8083,
"cds_end": null,
"cds_length": 9006,
"cdna_start": 8321,
"cdna_end": null,
"cdna_length": 12838,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 55,
"exon_rank_end": null,
"exon_count": 62,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8083_8103delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2695_Lys2701del",
"transcript": "XM_047426979.1",
"protein_id": "XP_047282935.1",
"transcript_support_level": null,
"aa_start": 2695,
"aa_end": null,
"aa_length": 3001,
"cds_start": 8083,
"cds_end": null,
"cds_length": 9006,
"cdna_start": 9183,
"cdna_end": null,
"cdna_length": 13700,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 60,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del",
"transcript": "XM_011542843.3",
"protein_id": "XP_011541145.1",
"transcript_support_level": null,
"aa_start": 2750,
"aa_end": null,
"aa_length": 2912,
"cds_start": 8248,
"cds_end": null,
"cds_length": 8739,
"cdna_start": 8398,
"cdna_end": null,
"cdna_length": 8923,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 52,
"exon_rank_end": null,
"exon_count": 59,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.7204_7224delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2402_Lys2408del",
"transcript": "XM_011542844.4",
"protein_id": "XP_011541146.1",
"transcript_support_level": null,
"aa_start": 2402,
"aa_end": null,
"aa_length": 2708,
"cds_start": 7204,
"cds_end": null,
"cds_length": 8127,
"cdna_start": 7819,
"cdna_end": null,
"cdna_length": 12336,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "LTICTYK",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 31,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "c.4204_4224delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu1402_Lys1408del",
"transcript": "XM_006718845.3",
"protein_id": "XP_006718908.1",
"transcript_support_level": null,
"aa_start": 1402,
"aa_end": null,
"aa_length": 1708,
"cds_start": 4204,
"cds_end": null,
"cds_length": 5127,
"cdna_start": 4274,
"cdna_end": null,
"cdna_length": 8791,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 30,
"exon_rank_end": null,
"exon_count": 37,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.4463_4483delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000524792.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5912,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 19,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.2667_2687delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000525056.2",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3608,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 55,
"exon_rank_end": null,
"exon_count": 62,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*2439_*2459delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000529588.6",
"protein_id": "ENSP00000435524.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12827,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.460_480delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000533979.5",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 705,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.946_966delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000638786.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4344,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 55,
"exon_rank_end": null,
"exon_count": 62,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*3383_*3403delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000675595.1",
"protein_id": "ENSP00000502563.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 9309,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 20,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.3005_3025delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000682286.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6403,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 19,
"exon_rank_end": null,
"exon_count": 26,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.2666_2686delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000682302.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6064,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*4656_*4676delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000683174.2",
"protein_id": "ENSP00000519136.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 13130,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 25,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.3472_3492delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000683524.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6870,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.3664_3684delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000684152.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7062,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.722_742delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000684180.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4120,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.4741_4761delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000684447.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8139,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*7719_*7739delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000713593.1",
"protein_id": "ENSP00000518889.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12893,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000713840.1",
"protein_id": "ENSP00000519145.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 9933,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 57,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*1874_*1894delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000713841.1",
"protein_id": "ENSP00000519146.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11890,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*902_*922delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000713842.1",
"protein_id": "ENSP00000519147.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11758,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000713843.1",
"protein_id": "ENSP00000519148.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 13126,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 55,
"exon_rank_end": null,
"exon_count": 62,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*2439_*2459delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000529588.6",
"protein_id": "ENSP00000435524.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12827,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 55,
"exon_rank_end": null,
"exon_count": 62,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*3383_*3403delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000675595.1",
"protein_id": "ENSP00000502563.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 9309,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*4656_*4676delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000683174.2",
"protein_id": "ENSP00000519136.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 13130,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*7719_*7739delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000713593.1",
"protein_id": "ENSP00000518889.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 12893,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 57,
"exon_rank_end": null,
"exon_count": 64,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*1874_*1894delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000713841.1",
"protein_id": "ENSP00000519146.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11890,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 56,
"exon_rank_end": null,
"exon_count": 63,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"hgvs_c": "n.*902_*922delTTAACTATCTGTACTTATAAG",
"hgvs_p": null,
"transcript": "ENST00000713842.1",
"protein_id": "ENSP00000519147.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 11758,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.641-26890_641-26870delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "NM_001330368.2",
"protein_id": "NP_001317297.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 246,
"cds_start": -4,
"cds_end": null,
"cds_length": 741,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1261,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.641-26890_641-26870delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "ENST00000525729.5",
"protein_id": "ENSP00000433395.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 246,
"cds_start": -4,
"cds_end": null,
"cds_length": 741,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1263,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.695-669_695-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "NM_001351110.2",
"protein_id": "NP_001338039.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 242,
"cds_start": -4,
"cds_end": null,
"cds_length": 729,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1388,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.225-669_225-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "ENST00000524755.5",
"protein_id": "ENSP00000432827.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": 104,
"cds_start": -4,
"cds_end": null,
"cds_length": 315,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 456,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "n.*1197-669_*1197-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "ENST00000527531.5",
"protein_id": "ENSP00000431706.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2683,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 11,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "n.2300-669_2300-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "NR_147053.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2741,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.732-669_732-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426458.1",
"protein_id": "XP_047282414.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 342,
"cds_start": -4,
"cds_end": null,
"cds_length": 1029,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1518,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.732-669_732-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426459.1",
"protein_id": "XP_047282415.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 342,
"cds_start": -4,
"cds_end": null,
"cds_length": 1029,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1425,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.732-669_732-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426460.1",
"protein_id": "XP_047282416.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 342,
"cds_start": -4,
"cds_end": null,
"cds_length": 1029,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2037,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.732-669_732-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426461.1",
"protein_id": "XP_047282417.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 342,
"cds_start": -4,
"cds_end": null,
"cds_length": 1029,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1436,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.678-669_678-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426462.1",
"protein_id": "XP_047282418.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 324,
"cds_start": -4,
"cds_end": null,
"cds_length": 975,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1371,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.639-669_639-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426463.1",
"protein_id": "XP_047282419.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 311,
"cds_start": -4,
"cds_end": null,
"cds_length": 936,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1332,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.788-26890_788-26870delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426466.1",
"protein_id": "XP_047282422.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 295,
"cds_start": -4,
"cds_end": null,
"cds_length": 888,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1501,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.585-669_585-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426467.1",
"protein_id": "XP_047282423.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 293,
"cds_start": -4,
"cds_end": null,
"cds_length": 882,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1278,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.788-669_788-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426470.1",
"protein_id": "XP_047282426.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 273,
"cds_start": -4,
"cds_end": null,
"cds_length": 822,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1390,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.732-669_732-649delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426471.1",
"protein_id": "XP_047282427.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 273,
"cds_start": -4,
"cds_end": null,
"cds_length": 822,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1334,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "C11orf65",
"gene_hgnc_id": 28519,
"hgvs_c": "c.695-26890_695-26870delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null,
"transcript": "XM_047426473.1",
"protein_id": "XP_047282429.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 264,
"cds_start": -4,
"cds_end": null,
"cds_length": 795,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1315,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "ATM",
"gene_hgnc_id": 795,
"dbsnp": "rs771146489",
"frequency_reference_population": 6.851155e-7,
"hom_count_reference_population": 0,
"allele_count_reference_population": 1,
"gnomad_exomes_af": 6.85115e-7,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": 1,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 7.574,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 4,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PM4,PP3,PP5",
"acmg_by_gene": [
{
"score": 4,
"benign_score": 0,
"pathogenic_score": 4,
"criteria": [
"PM4",
"PP3",
"PP5"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000675843.1",
"gene_symbol": "ATM",
"hgnc_id": 795,
"effects": [
"conservative_inframe_deletion",
"splice_region_variant"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.8248_8268delTTAACTATCTGTACTTATAAG",
"hgvs_p": "p.Leu2750_Lys2756del"
},
{
"score": 2,
"benign_score": 0,
"pathogenic_score": 2,
"criteria": [
"PP3",
"PP5"
],
"verdict": "Uncertain_significance",
"transcript": "NM_001330368.2",
"gene_symbol": "C11orf65",
"hgnc_id": 28519,
"effects": [
"intron_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.641-26890_641-26870delCTTATAAGTACAGATAGTTAA",
"hgvs_p": null
}
],
"clinvar_disease": "Ataxia-telangiectasia syndrome,Familial cancer of breast,Hereditary cancer-predisposing syndrome,not provided",
"clinvar_classification": "Conflicting classifications of pathogenicity",
"clinvar_review_status": "criteria provided, conflicting classifications",
"clinvar_submissions_summary": "LP:2 US:2",
"phenotype_combined": "not provided|Ataxia-telangiectasia syndrome|Hereditary cancer-predisposing syndrome|Familial cancer of breast",
"pathogenicity_classification_combined": "Conflicting classifications of pathogenicity",
"custom_annotations": null
}
],
"message": null
}