← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 11-128693941-CGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=11&pos=128693941&ref=CGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA&alt=C&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "11",
"pos": 128693941,
"ref": "CGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"alt": "C",
"effect": "5_prime_UTR_variant",
"transcript": "ENST00000281428.12",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-672_-635delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "ENST00000281428.12",
"protein_id": "ENSP00000281428.8",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 386,
"cds_start": -4,
"cds_end": null,
"cds_length": 1161,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4151,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "SENCR",
"gene_hgnc_id": 44177,
"hgvs_c": "n.112-588_112-551delTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC",
"hgvs_p": null,
"transcript": "ENST00000526269.2",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1298,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.39+7255_39+7292delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "ENST00000696982.1",
"protein_id": "ENSP00000513017.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 459,
"cds_start": -4,
"cds_end": null,
"cds_length": 1380,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2940,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-82+813_-82+850delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "NM_001440369.1",
"protein_id": "NP_001427298.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": -4,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3702,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-82+8584_-82+8621delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "NM_001440370.1",
"protein_id": "NP_001427299.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": -4,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3861,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-82+1156_-82+1193delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "NM_001440371.1",
"protein_id": "NP_001427300.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": -4,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3938,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-203+7255_-203+7292delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "NM_001271012.2",
"protein_id": "NP_001257941.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 259,
"cds_start": -4,
"cds_end": null,
"cds_length": 780,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3428,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-203+7255_-203+7292delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "ENST00000344954.10",
"protein_id": "ENSP00000339627.7",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 259,
"cds_start": -4,
"cds_end": null,
"cds_length": 780,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3427,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-82+813_-82+850delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "ENST00000527767.7",
"protein_id": "ENSP00000476428.1",
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": 105,
"cds_start": -4,
"cds_end": null,
"cds_length": 318,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 561,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "n.-82+7255_-82+7292delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "ENST00000608303.5",
"protein_id": "ENSP00000477262.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2577,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "SENCR",
"gene_hgnc_id": 44177,
"hgvs_c": "n.127-1858_127-1821delTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC",
"hgvs_p": null,
"transcript": "ENST00000685905.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 584,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "SENCR",
"gene_hgnc_id": 44177,
"hgvs_c": "n.112-588_112-551delTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC",
"hgvs_p": null,
"transcript": "NR_038908.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1298,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-317_-280delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "NM_002017.5",
"protein_id": "NP_002008.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 452,
"cds_start": -4,
"cds_end": null,
"cds_length": 1359,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3825,
"mane_select": "ENST00000527786.7",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-317_-280delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "ENST00000527786.7",
"protein_id": "ENSP00000433488.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 452,
"cds_start": -4,
"cds_end": null,
"cds_length": 1359,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3825,
"mane_select": "NM_002017.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "n.-317_-280delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "ENST00000429175.7",
"protein_id": "ENSP00000399985.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3130,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-470_-433delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "NM_001167681.3",
"protein_id": "NP_001161153.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": -4,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3879,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-470_-433delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "ENST00000534087.3",
"protein_id": "ENSP00000432950.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": -4,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3859,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-317_-280delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "NM_001440372.1",
"protein_id": "NP_001427301.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 410,
"cds_start": -4,
"cds_end": null,
"cds_length": 1233,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3699,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"hgvs_c": "c.-686_-649delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null,
"transcript": "NM_001271010.2",
"protein_id": "NP_001257939.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 386,
"cds_start": -4,
"cds_end": null,
"cds_length": 1161,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3996,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "FLI1",
"gene_hgnc_id": 3749,
"dbsnp": "rs57930585",
"frequency_reference_population": 0.000010648039,
"hom_count_reference_population": 0,
"allele_count_reference_population": 1,
"gnomad_exomes_af": 0.000010648,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": 1,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 2.85,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000281428.12",
"gene_symbol": "FLI1",
"hgnc_id": 3749,
"effects": [
"5_prime_UTR_variant"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.-672_-635delGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA",
"hgvs_p": null
},
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000526269.2",
"gene_symbol": "SENCR",
"hgnc_id": 44177,
"effects": [
"intron_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.112-588_112-551delTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}