← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 12-63808823-GACGTGATGACAGCTGGCAACTGTGGGAA-G (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=12&pos=63808823&ref=GACGTGATGACAGCTGGCAACTGTGGGAA&alt=G&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "12",
"pos": 63808823,
"ref": "GACGTGATGACAGCTGGCAACTGTGGGAA",
"alt": "G",
"effect": "frameshift_variant",
"transcript": "ENST00000261234.11",
"consequences": [
{
"aa_ref": "DVMTAGNCGN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": "p.Asp355fs",
"transcript": "NM_014254.3",
"protein_id": "NP_055069.1",
"transcript_support_level": null,
"aa_start": 355,
"aa_end": null,
"aa_length": 443,
"cds_start": 1064,
"cds_end": null,
"cds_length": 1332,
"cdna_start": 1116,
"cdna_end": null,
"cdna_length": 1854,
"mane_select": "ENST00000261234.11",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "DVMTAGNCGN",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": "p.Asp355fs",
"transcript": "ENST00000261234.11",
"protein_id": "ENSP00000261234.6",
"transcript_support_level": 1,
"aa_start": 355,
"aa_end": null,
"aa_length": 443,
"cds_start": 1064,
"cds_end": null,
"cds_length": 1332,
"cdna_start": 1116,
"cdna_end": null,
"cdna_length": 1854,
"mane_select": "NM_014254.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*799_*826delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000537373.6",
"protein_id": "ENSP00000440280.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1966,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*799_*826delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000537373.6",
"protein_id": "ENSP00000440280.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1966,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": null,
"protein_coding": null,
"strand": true,
"consequences": [
"bidirectional_gene_fusion"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": null,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.63808824_63808851delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": null,
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "DVMTAGNCGN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "c.284_311delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": "p.Asp95fs",
"transcript": "NM_001278237.2",
"protein_id": "NP_001265166.1",
"transcript_support_level": null,
"aa_start": 95,
"aa_end": null,
"aa_length": 183,
"cds_start": 284,
"cds_end": null,
"cds_length": 552,
"cdna_start": 1449,
"cdna_end": null,
"cdna_length": 2187,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "DVMTAGNCGN",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "c.755_782delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": "p.Asp252fs",
"transcript": "XM_047428078.1",
"protein_id": "XP_047284034.1",
"transcript_support_level": null,
"aa_start": 252,
"aa_end": null,
"aa_length": 340,
"cds_start": 755,
"cds_end": null,
"cds_length": 1023,
"cdna_start": 903,
"cdna_end": null,
"cdna_length": 1641,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.1850_1877delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000433461.2",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2002,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*865_*892delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000543342.5",
"protein_id": "ENSP00000440845.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1599,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1-AS1",
"gene_hgnc_id": 48910,
"hgvs_c": "n.557_*21delTTCCCACAGTTGCCAGCTGTCATCACGT",
"hgvs_p": null,
"transcript": "ENST00000546214.1",
"protein_id": null,
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 563,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 1,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.3874_3901delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000623171.1",
"protein_id": null,
"transcript_support_level": 6,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4531,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1-AS1",
"gene_hgnc_id": 48910,
"hgvs_c": "n.477_504delTTCCCACAGTTGCCAGCTGTCATCACGT",
"hgvs_p": null,
"transcript": "ENST00000649287.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1755,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*2607_*2634delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000685296.1",
"protein_id": "ENSP00000508796.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3868,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*723_*750delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000687087.1",
"protein_id": "ENSP00000510657.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1978,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*613_*640delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000690060.1",
"protein_id": "ENSP00000508435.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1943,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 5,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.1800_1827delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000691840.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2768,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*1056_*1083delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000692910.1",
"protein_id": "ENSP00000509763.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2159,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*1007_*1034delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000693579.1",
"protein_id": "ENSP00000510692.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2161,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1-AS1",
"gene_hgnc_id": 48910,
"hgvs_c": "n.324_351delTTCCCACAGTTGCCAGCTGTCATCACGT",
"hgvs_p": null,
"transcript": "ENST00000741152.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 597,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1-AS1",
"gene_hgnc_id": 48910,
"hgvs_c": "n.755_782delTTCCCACAGTTGCCAGCTGTCATCACGT",
"hgvs_p": null,
"transcript": "ENST00000741153.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1028,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1-AS1",
"gene_hgnc_id": 48910,
"hgvs_c": "n.557_*21delTTCCCACAGTTGCCAGCTGTCATCACGT",
"hgvs_p": null,
"transcript": "NR_126167.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 563,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*865_*892delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000543342.5",
"protein_id": "ENSP00000440845.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1599,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*2607_*2634delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000685296.1",
"protein_id": "ENSP00000508796.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3868,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*723_*750delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000687087.1",
"protein_id": "ENSP00000510657.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1978,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*613_*640delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000690060.1",
"protein_id": "ENSP00000508435.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1943,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*1056_*1083delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000692910.1",
"protein_id": "ENSP00000509763.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2159,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"hgvs_c": "n.*1007_*1034delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": null,
"transcript": "ENST00000693579.1",
"protein_id": "ENSP00000510692.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2161,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1-AS1",
"gene_hgnc_id": 48910,
"hgvs_c": "n.557_*21delTTCCCACAGTTGCCAGCTGTCATCACGT",
"hgvs_p": null,
"transcript": "ENST00000546214.1",
"protein_id": null,
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 563,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "RXYLT1-AS1",
"gene_hgnc_id": 48910,
"hgvs_c": "n.557_*21delTTCCCACAGTTGCCAGCTGTCATCACGT",
"hgvs_p": null,
"transcript": "NR_126167.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 563,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "RXYLT1",
"gene_hgnc_id": 13530,
"dbsnp": "rs397514545",
"frequency_reference_population": 0.000005472615,
"hom_count_reference_population": 0,
"allele_count_reference_population": 8,
"gnomad_exomes_af": 0.00000547262,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": 8,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.088,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 12,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1_Strong,PP5_Very_Strong",
"acmg_by_gene": [
{
"score": 12,
"benign_score": 0,
"pathogenic_score": 12,
"criteria": [
"PVS1_Strong",
"PP5_Very_Strong"
],
"verdict": "Pathogenic",
"transcript": "ENST00000261234.11",
"gene_symbol": "RXYLT1",
"hgnc_id": 13530,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.1064_1091delACGTGATGACAGCTGGCAACTGTGGGAA",
"hgvs_p": "p.Asp355fs"
},
{
"score": 9,
"benign_score": 0,
"pathogenic_score": 9,
"criteria": [
"PP3",
"PP5_Very_Strong"
],
"verdict": "Likely_pathogenic",
"transcript": "ENST00000546214.1",
"gene_symbol": "RXYLT1-AS1",
"hgnc_id": 48910,
"effects": [
"splice_region_variant",
"non_coding_transcript_exon_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.557_*21delTTCCCACAGTTGCCAGCTGTCATCACGT",
"hgvs_p": null
}
],
"clinvar_disease": " 10, type a,Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies),not provided",
"clinvar_classification": "Pathogenic/Likely pathogenic",
"clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
"clinvar_submissions_summary": "P:1 LP:1",
"phenotype_combined": "Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 10|not provided",
"pathogenicity_classification_combined": "Pathogenic/Likely pathogenic",
"custom_annotations": null
}
],
"message": null
}