← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 13-48303947-CCGCCGCCGCTGCCGCCGCGGAACCCCCGG-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=13&pos=48303947&ref=CCGCCGCCGCTGCCGCCGCGGAACCCCCGG&alt=C&genome=hg38&allGenes=true"API Response
json
{
"message": null,
"variants": [
{
"acmg_by_gene": [
{
"benign_score": 0,
"criteria": [
"PVS1",
"PP5_Very_Strong"
],
"effects": [
"frameshift_variant"
],
"gene_symbol": "RB1",
"hgnc_id": 9884,
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"inheritance_mode": "AD",
"pathogenic_score": 16,
"score": 16,
"transcript": "NM_000321.3",
"verdict": "Pathogenic"
},
{
"benign_score": 0,
"criteria": [
"PP5_Very_Strong"
],
"effects": [
"upstream_gene_variant"
],
"gene_symbol": "RB1-DT",
"hgnc_id": 42778,
"hgvs_c": "n.-253_-225delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"inheritance_mode": "",
"pathogenic_score": 8,
"score": 8,
"transcript": "ENST00000433480.4",
"verdict": "Likely_pathogenic"
}
],
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Very_Strong",
"acmg_score": 16,
"allele_count_reference_population": 0,
"alphamissense_prediction": null,
"alphamissense_score": null,
"alt": "C",
"apogee2_prediction": null,
"apogee2_score": null,
"bayesdelnoaf_prediction": null,
"bayesdelnoaf_score": null,
"chr": "13",
"clinvar_classification": "Pathogenic",
"clinvar_disease": "Retinoblastoma",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1",
"computational_prediction_selected": null,
"computational_score_selected": null,
"computational_source_selected": null,
"consequences": [
{
"aa_alt": null,
"aa_end": null,
"aa_length": 928,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4768,
"cdna_start": 199,
"cds_end": null,
"cds_length": 2787,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 27,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "NM_000321.3",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": "ENST00000267163.6",
"protein_coding": true,
"protein_id": "NP_000312.2",
"strand": true,
"transcript": "NM_000321.3",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 928,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": true,
"cdna_end": null,
"cdna_length": 4768,
"cdna_start": 199,
"cds_end": null,
"cds_length": 2787,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 27,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000267163.6",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": "NM_000321.3",
"protein_coding": true,
"protein_id": "ENSP00000267163.4",
"strand": true,
"transcript": "ENST00000267163.6",
"transcript_support_level": 1
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 4274,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 22,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000467505.6",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "n.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000434702.1",
"strand": true,
"transcript": "ENST00000467505.6",
"transcript_support_level": 1
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 969,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4903,
"cdna_start": 215,
"cds_end": null,
"cds_length": 2910,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 28,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000924352.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000594411.1",
"strand": true,
"transcript": "ENST00000924352.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 924,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4725,
"cdna_start": 172,
"cds_end": null,
"cds_length": 2775,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 27,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000859511.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000529570.1",
"strand": true,
"transcript": "ENST00000859511.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 923,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4787,
"cdna_start": 199,
"cds_end": null,
"cds_length": 2772,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 27,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "NM_001407165.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "NP_001394094.1",
"strand": true,
"transcript": "NM_001407165.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 923,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4629,
"cdna_start": 203,
"cds_end": null,
"cds_length": 2772,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 27,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000650461.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000497193.1",
"strand": true,
"transcript": "ENST00000650461.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 922,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4727,
"cdna_start": 181,
"cds_end": null,
"cds_length": 2769,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 27,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000941076.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000611135.1",
"strand": true,
"transcript": "ENST00000941076.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 893,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4552,
"cdna_start": 103,
"cds_end": null,
"cds_length": 2682,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 26,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000713858.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000519163.1",
"strand": true,
"transcript": "ENST00000713858.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 889,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4651,
"cdna_start": 199,
"cds_end": null,
"cds_length": 2670,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 26,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000859510.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000529569.1",
"strand": true,
"transcript": "ENST00000859510.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 877,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4504,
"cdna_start": 103,
"cds_end": null,
"cds_length": 2634,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 26,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000713857.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000519162.1",
"strand": true,
"transcript": "ENST00000713857.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 851,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4110,
"cdna_start": 195,
"cds_end": null,
"cds_length": 2556,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 25,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000713856.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000519161.1",
"strand": true,
"transcript": "ENST00000713856.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 568,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 6581,
"cdna_start": 199,
"cds_end": null,
"cds_length": 1707,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 17,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "NM_001407166.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "NP_001394095.1",
"strand": true,
"transcript": "NM_001407166.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 103,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 2322,
"cdna_start": 199,
"cds_end": null,
"cds_length": 312,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 3,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "NM_001407167.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "NP_001394096.1",
"strand": true,
"transcript": "NM_001407167.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 103,
"aa_ref": "AAAAAAEPPA",
"aa_start": 13,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 633,
"cdna_start": 206,
"cds_end": null,
"cds_length": 312,
"cds_start": 37,
"consequences": [
"frameshift_variant"
],
"exon_count": 3,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000646097.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": "p.Ala13fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000496556.1",
"strand": true,
"transcript": "ENST00000646097.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "retained_intron",
"canonical": false,
"cdna_end": null,
"cdna_length": 1490,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 7,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000525036.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "n.199_227delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000525036.1",
"transcript_support_level": 3
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 4494,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 26,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000713859.1",
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"hgvs_c": "n.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000519164.1",
"strand": true,
"transcript": "ENST00000713859.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 1607,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 3,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000433480.4",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-253_-225delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000433480.4",
"transcript_support_level": 1
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 1410,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 3,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000436963.3",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-256_-228delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000436963.3",
"transcript_support_level": 3
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 1407,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 3,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000700890.2",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-253_-225delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000700890.2",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 739,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 3,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000718572.1",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-253_-225delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000718572.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 1169,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 4,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000718576.1",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-253_-225delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000718576.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 1188,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 3,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000718577.1",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-274_-246delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000718577.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 1319,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 4,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000718578.1",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-274_-246delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000718578.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 1463,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 2,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000718582.1",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-253_-225delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000718582.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 617,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 2,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000718583.1",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-255_-227delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000718583.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 652,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 1,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000718584.1",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-262_-234delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000718584.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 1184,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 3,
"exon_rank": null,
"exon_rank_end": null,
"feature": "NR_046414.2",
"gene_hgnc_id": 42778,
"gene_symbol": "RB1-DT",
"hgvs_c": "n.-274_-246delCCGGGGGTTCCGCGGCGGCAGCGGCGGCG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "NR_046414.2",
"transcript_support_level": null
}
],
"custom_annotations": null,
"dbscsnv_ada_prediction": null,
"dbscsnv_ada_score": null,
"dbsnp": "rs1064792974",
"effect": "frameshift_variant",
"frequency_reference_population": null,
"gene_hgnc_id": 9884,
"gene_symbol": "RB1",
"gnomad_exomes_ac": null,
"gnomad_exomes_af": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_ac": null,
"gnomad_genomes_af": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_heteroplasmic": null,
"gnomad_mito_homoplasmic": null,
"hom_count_reference_population": 0,
"mitotip_prediction": null,
"mitotip_score": null,
"pathogenicity_classification_combined": "Pathogenic",
"phenotype_combined": "Retinoblastoma",
"phylop100way_prediction": "Benign",
"phylop100way_score": 1.494,
"pos": 48303947,
"ref": "CCGCCGCCGCTGCCGCCGCGGAACCCCCGG",
"revel_prediction": null,
"revel_score": null,
"splice_prediction_selected": null,
"splice_score_selected": null,
"splice_source_selected": null,
"spliceai_max_prediction": null,
"spliceai_max_score": null,
"transcript": "NM_000321.3"
}
]
}