← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 14-24964647-C-CTGTGTGTGTGTGTGTGTGTG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=14&pos=24964647&ref=C&alt=CTGTGTGTGTGTGTGTGTGTG&genome=hg38&allGenes=true"
API Response
json
{
"variants": [
{
"chr": "14",
"pos": 24964647,
"ref": "C",
"alt": "CTGTGTGTGTGTGTGTGTGTG",
"effect": "intron_variant",
"transcript": "ENST00000323944.10",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394410.1",
"protein_id": "NP_001381339.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4190,
"mane_select": "ENST00000323944.10",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "ENST00000323944.10",
"protein_id": "ENSP00000324302.5",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4190,
"mane_select": "NM_001394410.1",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "ENST00000396700.5",
"protein_id": "ENSP00000379928.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4021,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "ENST00000419632.6",
"protein_id": "ENSP00000397212.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1970,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "ENST00000546511.5",
"protein_id": "ENSP00000449536.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1223,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001304476.3",
"protein_id": "NP_001291405.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4306,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001304477.3",
"protein_id": "NP_001291406.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3961,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001351940.3",
"protein_id": "NP_001338869.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4277,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001351941.3",
"protein_id": "NP_001338870.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4283,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001351942.3",
"protein_id": "NP_001338871.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4266,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001351943.3",
"protein_id": "NP_001338872.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4937,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394411.1",
"protein_id": "NP_001381340.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4049,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394412.1",
"protein_id": "NP_001381341.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4982,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394413.1",
"protein_id": "NP_001381342.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3962,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394414.1",
"protein_id": "NP_001381343.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4945,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394415.1",
"protein_id": "NP_001381344.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4384,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394416.1",
"protein_id": "NP_001381345.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4078,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_014178.9",
"protein_id": "NP_054897.4",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4861,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "ENST00000550887.5",
"protein_id": "ENSP00000449379.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1311,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394417.1",
"protein_id": "NP_001381346.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 203,
"cds_start": -4,
"cds_end": null,
"cds_length": 612,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4057,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.-87+85211_-87+85230dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394418.1",
"protein_id": "NP_001381347.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 130,
"cds_start": -4,
"cds_end": null,
"cds_length": 393,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4004,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.-87+45858_-87+45877dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394419.1",
"protein_id": "NP_001381348.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 130,
"cds_start": -4,
"cds_end": null,
"cds_length": 393,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3892,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "NM_001394420.1",
"protein_id": "NP_001381349.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 111,
"cds_start": -4,
"cds_end": null,
"cds_length": 336,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3893,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "n.154+10017_154+10018insCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "ENST00000548182.1",
"protein_id": "ENSP00000447268.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3355,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.190+9998_190+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_047431293.1",
"protein_id": "XP_047287249.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 222,
"cds_start": -4,
"cds_end": null,
"cds_length": 669,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4393,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_017021241.2",
"protein_id": "XP_016876730.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3941,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_024449547.2",
"protein_id": "XP_024305315.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4112,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_047431294.1",
"protein_id": "XP_047287250.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4306,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_047431295.1",
"protein_id": "XP_047287251.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4199,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_047431296.1",
"protein_id": "XP_047287252.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4219,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.154+9998_154+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_047431298.1",
"protein_id": "XP_047287254.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 210,
"cds_start": -4,
"cds_end": null,
"cds_length": 633,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4230,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.-319+9998_-319+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_006720121.5",
"protein_id": "XP_006720184.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 130,
"cds_start": -4,
"cds_end": null,
"cds_length": 393,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4152,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.-157+9998_-157+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_047431299.1",
"protein_id": "XP_047287255.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 130,
"cds_start": -4,
"cds_end": null,
"cds_length": 393,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3990,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"hgvs_c": "c.-249+9998_-249+10017dupCACACACACACACACACACA",
"hgvs_p": null,
"transcript": "XM_047431300.1",
"protein_id": "XP_047287256.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 130,
"cds_start": -4,
"cds_end": null,
"cds_length": 393,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4082,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "STXBP6",
"gene_hgnc_id": 19666,
"dbsnp": "rs34132743",
"frequency_reference_population": 0.0074413894,
"hom_count_reference_population": 11,
"allele_count_reference_population": 1043,
"gnomad_exomes_af": null,
"gnomad_genomes_af": 0.00744139,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": 1043,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": 11,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.045,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -4,
"acmg_classification": "Likely_benign",
"acmg_criteria": "BS2",
"acmg_by_gene": [
{
"score": -4,
"benign_score": 4,
"pathogenic_score": 0,
"criteria": [
"BS2"
],
"verdict": "Likely_benign",
"transcript": "ENST00000323944.10",
"gene_symbol": "STXBP6",
"hgnc_id": 19666,
"effects": [
"intron_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACA",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}