← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 14-24964647-C-CTGTGTGTGTGTGTGTGTGTGTGTG (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=14&pos=24964647&ref=C&alt=CTGTGTGTGTGTGTGTGTGTGTGTG&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "14",
      "pos": 24964647,
      "ref": "C",
      "alt": "CTGTGTGTGTGTGTGTGTGTGTGTG",
      "effect": "intron_variant",
      "transcript": "ENST00000323944.10",
      "consequences": [
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394410.1",
          "protein_id": "NP_001381339.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4190,
          "mane_select": "ENST00000323944.10",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "ENST00000323944.10",
          "protein_id": "ENSP00000324302.5",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4190,
          "mane_select": "NM_001394410.1",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "ENST00000396700.5",
          "protein_id": "ENSP00000379928.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4021,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "ENST00000419632.6",
          "protein_id": "ENSP00000397212.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1970,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "ENST00000546511.5",
          "protein_id": "ENSP00000449536.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1223,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001304476.3",
          "protein_id": "NP_001291405.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4306,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001304477.3",
          "protein_id": "NP_001291406.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3961,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001351940.3",
          "protein_id": "NP_001338869.2",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4277,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001351941.3",
          "protein_id": "NP_001338870.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4283,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001351942.3",
          "protein_id": "NP_001338871.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4266,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001351943.3",
          "protein_id": "NP_001338872.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4937,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394411.1",
          "protein_id": "NP_001381340.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4049,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394412.1",
          "protein_id": "NP_001381341.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4982,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394413.1",
          "protein_id": "NP_001381342.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3962,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394414.1",
          "protein_id": "NP_001381343.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4945,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394415.1",
          "protein_id": "NP_001381344.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4384,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394416.1",
          "protein_id": "NP_001381345.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4078,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_014178.9",
          "protein_id": "NP_054897.4",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4861,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "ENST00000550887.5",
          "protein_id": "ENSP00000449379.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1311,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394417.1",
          "protein_id": "NP_001381346.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 203,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 612,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4057,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.-87+85207_-87+85230dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394418.1",
          "protein_id": "NP_001381347.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 130,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 393,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4004,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.-87+45854_-87+45877dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394419.1",
          "protein_id": "NP_001381348.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 130,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 393,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3892,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "NM_001394420.1",
          "protein_id": "NP_001381349.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 111,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 336,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3893,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "n.154+10017_154+10018insCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "ENST00000548182.1",
          "protein_id": "ENSP00000447268.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3355,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.190+9994_190+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_047431293.1",
          "protein_id": "XP_047287249.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 222,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 669,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4393,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_017021241.2",
          "protein_id": "XP_016876730.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3941,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_024449547.2",
          "protein_id": "XP_024305315.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4112,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": 5,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_047431294.1",
          "protein_id": "XP_047287250.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4306,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_047431295.1",
          "protein_id": "XP_047287251.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4199,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_047431296.1",
          "protein_id": "XP_047287252.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4219,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.154+9994_154+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_047431298.1",
          "protein_id": "XP_047287254.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 210,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 633,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4230,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.-319+9994_-319+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_006720121.5",
          "protein_id": "XP_006720184.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 130,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 393,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4152,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.-157+9994_-157+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_047431299.1",
          "protein_id": "XP_047287255.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 130,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 393,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3990,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "STXBP6",
          "gene_hgnc_id": 19666,
          "hgvs_c": "c.-249+9994_-249+10017dupCACACACACACACACACACACACA",
          "hgvs_p": null,
          "transcript": "XM_047431300.1",
          "protein_id": "XP_047287256.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 130,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 393,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4082,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "STXBP6",
      "gene_hgnc_id": 19666,
      "dbsnp": "rs34132743",
      "frequency_reference_population": 0.0012483059,
      "hom_count_reference_population": 2,
      "allele_count_reference_population": 175,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": 0.00124831,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": 175,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": 2,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 0.045,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": -4,
      "acmg_classification": "Likely_benign",
      "acmg_criteria": "BS2",
      "acmg_by_gene": [
        {
          "score": -4,
          "benign_score": 4,
          "pathogenic_score": 0,
          "criteria": [
            "BS2"
          ],
          "verdict": "Likely_benign",
          "transcript": "ENST00000323944.10",
          "gene_symbol": "STXBP6",
          "hgnc_id": 19666,
          "effects": [
            "intron_variant"
          ],
          "inheritance_mode": "AR",
          "hgvs_c": "c.154+10017_154+10018insCACACACACACACACACACACACA",
          "hgvs_p": null
        }
      ],
      "clinvar_disease": "",
      "clinvar_classification": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "phenotype_combined": null,
      "pathogenicity_classification_combined": null,
      "custom_annotations": null
    }
  ],
  "message": null
}