← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 15-80153034-CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=15&pos=80153034&ref=CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG&alt=C&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "15",
"pos": 80153034,
"ref": "CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG",
"alt": "C",
"effect": "start_lost,conservative_inframe_deletion",
"transcript": "NM_000137.4",
"consequences": [
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "NM_000137.4",
"protein_id": "NP_000128.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000561421.6",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_000137.4"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000561421.6",
"protein_id": "ENSP00000453347.2",
"transcript_support_level": 1,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "NM_000137.4",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000561421.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "NM_000137.4",
"protein_id": "NP_000128.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000561421.6",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_000137.4"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000561421.6",
"protein_id": "ENSP00000453347.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "NM_000137.4",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000561421.6"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000874657.1",
"protein_id": "ENSP00000544716.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 453,
"cds_start": 1,
"cds_end": null,
"cds_length": 1362,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874657.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000929198.1",
"protein_id": "ENSP00000599257.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 453,
"cds_start": 1,
"cds_end": null,
"cds_length": 1362,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000929198.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "NM_001374377.1",
"protein_id": "NP_001361306.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001374377.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "NM_001374380.1",
"protein_id": "NP_001361309.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001374380.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000261755.9",
"protein_id": "ENSP00000261755.5",
"transcript_support_level": 5,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000261755.9"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000407106.5",
"protein_id": "ENSP00000385080.1",
"transcript_support_level": 5,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000407106.5"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000874652.1",
"protein_id": "ENSP00000544711.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874652.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000874653.1",
"protein_id": "ENSP00000544712.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874653.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000874654.1",
"protein_id": "ENSP00000544713.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874654.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000960159.1",
"protein_id": "ENSP00000630218.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960159.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000960160.1",
"protein_id": "ENSP00000630219.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960160.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000960162.1",
"protein_id": "ENSP00000630221.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 418,
"cds_start": 1,
"cds_end": null,
"cds_length": 1257,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960162.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000960163.1",
"protein_id": "ENSP00000630222.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 418,
"cds_start": 1,
"cds_end": null,
"cds_length": 1257,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960163.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000929199.1",
"protein_id": "ENSP00000599258.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 413,
"cds_start": 1,
"cds_end": null,
"cds_length": 1242,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000929199.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000960164.1",
"protein_id": "ENSP00000630223.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 397,
"cds_start": 1,
"cds_end": null,
"cds_length": 1194,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960164.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000874655.1",
"protein_id": "ENSP00000544714.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 385,
"cds_start": 1,
"cds_end": null,
"cds_length": 1158,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874655.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000960161.1",
"protein_id": "ENSP00000630220.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 385,
"cds_start": 1,
"cds_end": null,
"cds_length": 1158,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960161.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000874658.1",
"protein_id": "ENSP00000544717.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 384,
"cds_start": 1,
"cds_end": null,
"cds_length": 1155,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874658.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000874659.1",
"protein_id": "ENSP00000544718.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 382,
"cds_start": 1,
"cds_end": null,
"cds_length": 1149,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874659.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000537726.5",
"protein_id": "ENSP00000507608.1",
"transcript_support_level": 2,
"aa_start": 1,
"aa_end": null,
"aa_length": 174,
"cds_start": 1,
"cds_end": null,
"cds_length": 525,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000537726.5"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000558022.5",
"protein_id": "ENSP00000453152.1",
"transcript_support_level": 4,
"aa_start": 1,
"aa_end": null,
"aa_length": 160,
"cds_start": 1,
"cds_end": null,
"cds_length": 483,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000558022.5"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000558767.6",
"protein_id": "ENSP00000507680.1",
"transcript_support_level": 2,
"aa_start": 1,
"aa_end": null,
"aa_length": 160,
"cds_start": 1,
"cds_end": null,
"cds_length": 483,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000558767.6"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"frameshift_variant",
"start_lost"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1fs",
"transcript": "ENST00000684363.1",
"protein_id": "ENSP00000507314.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 133,
"cds_start": 1,
"cds_end": null,
"cds_length": 402,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000684363.1"
},
{
"aa_ref": "MSFIPVA",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"start_lost",
"conservative_inframe_deletion",
"splice_region_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del",
"transcript": "ENST00000874656.1",
"protein_id": "ENSP00000544715.1",
"transcript_support_level": null,
"aa_start": 1,
"aa_end": null,
"aa_length": 419,
"cds_start": 1,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874656.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000874657.1",
"protein_id": "ENSP00000544716.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 453,
"cds_start": null,
"cds_end": null,
"cds_length": 1362,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874657.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000929198.1",
"protein_id": "ENSP00000599257.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 453,
"cds_start": null,
"cds_end": null,
"cds_length": 1362,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000929198.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "NM_001374377.1",
"protein_id": "NP_001361306.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001374377.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "NM_001374380.1",
"protein_id": "NP_001361309.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001374380.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000261755.9",
"protein_id": "ENSP00000261755.5",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000261755.9"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000407106.5",
"protein_id": "ENSP00000385080.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000407106.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000874652.1",
"protein_id": "ENSP00000544711.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874652.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000874653.1",
"protein_id": "ENSP00000544712.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874653.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000874654.1",
"protein_id": "ENSP00000544713.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874654.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000874656.1",
"protein_id": "ENSP00000544715.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874656.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000960159.1",
"protein_id": "ENSP00000630218.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960159.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000960160.1",
"protein_id": "ENSP00000630219.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 419,
"cds_start": null,
"cds_end": null,
"cds_length": 1260,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960160.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000960162.1",
"protein_id": "ENSP00000630221.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 418,
"cds_start": null,
"cds_end": null,
"cds_length": 1257,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960162.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000960163.1",
"protein_id": "ENSP00000630222.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 418,
"cds_start": null,
"cds_end": null,
"cds_length": 1257,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960163.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000929199.1",
"protein_id": "ENSP00000599258.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 413,
"cds_start": null,
"cds_end": null,
"cds_length": 1242,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000929199.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000960164.1",
"protein_id": "ENSP00000630223.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 397,
"cds_start": null,
"cds_end": null,
"cds_length": 1194,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960164.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000874655.1",
"protein_id": "ENSP00000544714.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 385,
"cds_start": null,
"cds_end": null,
"cds_length": 1158,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874655.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000960161.1",
"protein_id": "ENSP00000630220.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 385,
"cds_start": null,
"cds_end": null,
"cds_length": 1158,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960161.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000874658.1",
"protein_id": "ENSP00000544717.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 384,
"cds_start": null,
"cds_end": null,
"cds_length": 1155,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874658.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000874659.1",
"protein_id": "ENSP00000544718.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 382,
"cds_start": null,
"cds_end": null,
"cds_length": 1149,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000874659.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000537726.5",
"protein_id": "ENSP00000507608.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 174,
"cds_start": null,
"cds_end": null,
"cds_length": 525,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000537726.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000558022.5",
"protein_id": "ENSP00000453152.1",
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": 160,
"cds_start": null,
"cds_end": null,
"cds_length": 483,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000558022.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000558767.6",
"protein_id": "ENSP00000507680.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 160,
"cds_start": null,
"cds_end": null,
"cds_length": 483,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000558767.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "n.62_100delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000561369.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000561369.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "n.57_95delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000682012.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000682012.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "n.27_65delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": null,
"transcript": "ENST00000684569.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000684569.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"hgvs_c": "c.-20_19delCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG",
"hgvs_p": null,
"transcript": "ENST00000684363.1",
"protein_id": "ENSP00000507314.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 133,
"cds_start": null,
"cds_end": null,
"cds_length": 402,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000684363.1"
}
],
"gene_symbol": "FAH",
"gene_hgnc_id": 3579,
"dbsnp": null,
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.944,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 12,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PS1_Moderate,PP5_Moderate",
"acmg_by_gene": [
{
"score": 12,
"benign_score": 0,
"pathogenic_score": 12,
"criteria": [
"PVS1",
"PS1_Moderate",
"PP5_Moderate"
],
"verdict": "Pathogenic",
"transcript": "NM_000137.4",
"gene_symbol": "FAH",
"hgnc_id": 3579,
"effects": [
"start_lost",
"conservative_inframe_deletion"
],
"inheritance_mode": "AR",
"hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
"hgvs_p": "p.Met1_Ala7del"
}
],
"clinvar_disease": "Tyrosinemia type I",
"clinvar_classification": "Likely pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "LP:1",
"phenotype_combined": "Tyrosinemia type I",
"pathogenicity_classification_combined": "Likely pathogenic",
"custom_annotations": null
}
],
"message": null
}