← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 15-80153034-CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG-C (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=15&pos=80153034&ref=CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG&alt=C&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "15",
      "pos": 80153034,
      "ref": "CCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG",
      "alt": "C",
      "effect": "start_lost,conservative_inframe_deletion",
      "transcript": "NM_000137.4",
      "consequences": [
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "NM_000137.4",
          "protein_id": "NP_000128.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": "ENST00000561421.6",
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_000137.4"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000561421.6",
          "protein_id": "ENSP00000453347.2",
          "transcript_support_level": 1,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": "NM_000137.4",
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000561421.6"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "NM_000137.4",
          "protein_id": "NP_000128.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": "ENST00000561421.6",
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_000137.4"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000561421.6",
          "protein_id": "ENSP00000453347.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": "NM_000137.4",
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000561421.6"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000874657.1",
          "protein_id": "ENSP00000544716.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 453,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1362,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874657.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000929198.1",
          "protein_id": "ENSP00000599257.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 453,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1362,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000929198.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "NM_001374377.1",
          "protein_id": "NP_001361306.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001374377.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "NM_001374380.1",
          "protein_id": "NP_001361309.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001374380.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000261755.9",
          "protein_id": "ENSP00000261755.5",
          "transcript_support_level": 5,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000261755.9"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000407106.5",
          "protein_id": "ENSP00000385080.1",
          "transcript_support_level": 5,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000407106.5"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000874652.1",
          "protein_id": "ENSP00000544711.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874652.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000874653.1",
          "protein_id": "ENSP00000544712.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874653.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000874654.1",
          "protein_id": "ENSP00000544713.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874654.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000960159.1",
          "protein_id": "ENSP00000630218.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960159.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000960160.1",
          "protein_id": "ENSP00000630219.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960160.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000960162.1",
          "protein_id": "ENSP00000630221.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 418,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1257,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960162.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000960163.1",
          "protein_id": "ENSP00000630222.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 418,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1257,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960163.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000929199.1",
          "protein_id": "ENSP00000599258.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 413,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1242,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000929199.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000960164.1",
          "protein_id": "ENSP00000630223.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 397,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1194,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960164.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000874655.1",
          "protein_id": "ENSP00000544714.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 385,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1158,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874655.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000960161.1",
          "protein_id": "ENSP00000630220.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 385,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1158,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960161.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000874658.1",
          "protein_id": "ENSP00000544717.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 384,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1155,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874658.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000874659.1",
          "protein_id": "ENSP00000544718.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 382,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1149,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874659.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000537726.5",
          "protein_id": "ENSP00000507608.1",
          "transcript_support_level": 2,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 174,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 525,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000537726.5"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000558022.5",
          "protein_id": "ENSP00000453152.1",
          "transcript_support_level": 4,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 160,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 483,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000558022.5"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000558767.6",
          "protein_id": "ENSP00000507680.1",
          "transcript_support_level": 2,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 160,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 483,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000558767.6"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "frameshift_variant",
            "start_lost"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1fs",
          "transcript": "ENST00000684363.1",
          "protein_id": "ENSP00000507314.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 133,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 402,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000684363.1"
        },
        {
          "aa_ref": "MSFIPVA",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "start_lost",
            "conservative_inframe_deletion",
            "splice_region_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del",
          "transcript": "ENST00000874656.1",
          "protein_id": "ENSP00000544715.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874656.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000874657.1",
          "protein_id": "ENSP00000544716.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 453,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1362,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874657.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000929198.1",
          "protein_id": "ENSP00000599257.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 453,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1362,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000929198.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "NM_001374377.1",
          "protein_id": "NP_001361306.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001374377.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "NM_001374380.1",
          "protein_id": "NP_001361309.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001374380.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000261755.9",
          "protein_id": "ENSP00000261755.5",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000261755.9"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000407106.5",
          "protein_id": "ENSP00000385080.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000407106.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000874652.1",
          "protein_id": "ENSP00000544711.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874652.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000874653.1",
          "protein_id": "ENSP00000544712.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874653.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000874654.1",
          "protein_id": "ENSP00000544713.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874654.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000874656.1",
          "protein_id": "ENSP00000544715.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874656.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000960159.1",
          "protein_id": "ENSP00000630218.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960159.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000960160.1",
          "protein_id": "ENSP00000630219.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 419,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1260,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960160.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000960162.1",
          "protein_id": "ENSP00000630221.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 418,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1257,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960162.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000960163.1",
          "protein_id": "ENSP00000630222.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 418,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1257,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960163.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000929199.1",
          "protein_id": "ENSP00000599258.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 413,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1242,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000929199.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000960164.1",
          "protein_id": "ENSP00000630223.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 397,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1194,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960164.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000874655.1",
          "protein_id": "ENSP00000544714.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 385,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1158,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874655.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000960161.1",
          "protein_id": "ENSP00000630220.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 385,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1158,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000960161.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000874658.1",
          "protein_id": "ENSP00000544717.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 384,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1155,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874658.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000874659.1",
          "protein_id": "ENSP00000544718.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 382,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1149,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000874659.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000537726.5",
          "protein_id": "ENSP00000507608.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 174,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 525,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000537726.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000558022.5",
          "protein_id": "ENSP00000453152.1",
          "transcript_support_level": 4,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 160,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 483,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000558022.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000558767.6",
          "protein_id": "ENSP00000507680.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 160,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 483,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000558767.6"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "n.62_100delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000561369.1",
          "protein_id": null,
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "retained_intron",
          "feature": "ENST00000561369.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "n.57_95delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000682012.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "retained_intron",
          "feature": "ENST00000682012.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "n.27_65delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": null,
          "transcript": "ENST00000684569.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "pseudogene",
          "feature": "ENST00000684569.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FAH",
          "gene_hgnc_id": 3579,
          "hgvs_c": "c.-20_19delCGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGG",
          "hgvs_p": null,
          "transcript": "ENST00000684363.1",
          "protein_id": "ENSP00000507314.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 133,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 402,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000684363.1"
        }
      ],
      "gene_symbol": "FAH",
      "gene_hgnc_id": 3579,
      "dbsnp": null,
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 0.944,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 12,
      "acmg_classification": "Pathogenic",
      "acmg_criteria": "PVS1,PS1_Moderate,PP5_Moderate",
      "acmg_by_gene": [
        {
          "score": 12,
          "benign_score": 0,
          "pathogenic_score": 12,
          "criteria": [
            "PVS1",
            "PS1_Moderate",
            "PP5_Moderate"
          ],
          "verdict": "Pathogenic",
          "transcript": "NM_000137.4",
          "gene_symbol": "FAH",
          "hgnc_id": 3579,
          "effects": [
            "start_lost",
            "conservative_inframe_deletion"
          ],
          "inheritance_mode": "AR",
          "hgvs_c": "c.-19_20delGTGCCGGGTGCTCTTCAGCATGTCCTTCATCCCGGTGGC",
          "hgvs_p": "p.Met1_Ala7del"
        }
      ],
      "clinvar_disease": "Tyrosinemia type I",
      "clinvar_classification": "Likely pathogenic",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "LP:1",
      "phenotype_combined": "Tyrosinemia type I",
      "pathogenicity_classification_combined": "Likely pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}