← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 16-15726912-TGCAGCTCCTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCC-T (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=16&pos=15726912&ref=TGCAGCTCCTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCC&alt=T&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "16",
      "pos": 15726912,
      "ref": "TGCAGCTCCTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCC",
      "alt": "T",
      "effect": "disruptive_inframe_deletion",
      "transcript": "ENST00000300036.6",
      "consequences": [
        {
          "aa_ref": "RVLGQAKQEVEHKKKKLEAQVQELQ",
          "aa_alt": "Q",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 28,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1241_Leu1264del",
          "transcript": "NM_002474.3",
          "protein_id": "NP_002465.1",
          "transcript_support_level": null,
          "aa_start": 1241,
          "aa_end": null,
          "aa_length": 1972,
          "cds_start": 3722,
          "cds_end": null,
          "cds_length": 5919,
          "cdna_start": 3898,
          "cdna_end": null,
          "cdna_length": 6880,
          "mane_select": "ENST00000300036.6",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RVLGQAKQEVEHKKKKLEAQVQELQ",
          "aa_alt": "Q",
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 28,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1241_Leu1264del",
          "transcript": "ENST00000300036.6",
          "protein_id": "ENSP00000300036.5",
          "transcript_support_level": 1,
          "aa_start": 1241,
          "aa_end": null,
          "aa_length": 1972,
          "cds_start": 3722,
          "cds_end": null,
          "cds_length": 5919,
          "cdna_start": 3898,
          "cdna_end": null,
          "cdna_length": 6880,
          "mane_select": "NM_002474.3",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RVLGQAKQEVEHKKKKLEAQVQELQ",
          "aa_alt": "Q",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 29,
          "exon_rank_end": null,
          "exon_count": 43,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "c.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1248_Leu1271del",
          "transcript": "NM_001040113.2",
          "protein_id": "NP_001035202.1",
          "transcript_support_level": null,
          "aa_start": 1248,
          "aa_end": null,
          "aa_length": 1945,
          "cds_start": 3743,
          "cds_end": null,
          "cds_length": 5838,
          "cdna_start": 3919,
          "cdna_end": null,
          "cdna_length": 6940,
          "mane_select": null,
          "mane_plus": "ENST00000452625.7",
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RVLGQAKQEVEHKKKKLEAQVQELQ",
          "aa_alt": "Q",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 29,
          "exon_rank_end": null,
          "exon_count": 43,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "c.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1248_Leu1271del",
          "transcript": "ENST00000452625.7",
          "protein_id": "ENSP00000407821.2",
          "transcript_support_level": 1,
          "aa_start": 1248,
          "aa_end": null,
          "aa_length": 1945,
          "cds_start": 3743,
          "cds_end": null,
          "cds_length": 5838,
          "cdna_start": 3919,
          "cdna_end": null,
          "cdna_length": 6940,
          "mane_select": null,
          "mane_plus": "NM_001040113.2",
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RVLGQAKQEVEHKKKKLEAQVQELQ",
          "aa_alt": "Q",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 29,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "c.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1248_Leu1271del",
          "transcript": "ENST00000396324.7",
          "protein_id": "ENSP00000379616.3",
          "transcript_support_level": 1,
          "aa_start": 1248,
          "aa_end": null,
          "aa_length": 1979,
          "cds_start": 3743,
          "cds_end": null,
          "cds_length": 5940,
          "cdna_start": 3902,
          "cdna_end": null,
          "cdna_length": 6847,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RVLGQAKQEVEHKKKKLEAQVQELQ",
          "aa_alt": "Q",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 28,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1241_Leu1264del",
          "transcript": "ENST00000576790.7",
          "protein_id": "ENSP00000458731.1",
          "transcript_support_level": 1,
          "aa_start": 1241,
          "aa_end": null,
          "aa_length": 1938,
          "cds_start": 3722,
          "cds_end": null,
          "cds_length": 5817,
          "cdna_start": 3864,
          "cdna_end": null,
          "cdna_length": 5907,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RVLGQAKQEVEHKKKKLEAQVQELQ",
          "aa_alt": "Q",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 29,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "c.3743_3814delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1248_Leu1271del",
          "transcript": "NM_001040114.2",
          "protein_id": "NP_001035203.1",
          "transcript_support_level": null,
          "aa_start": 1248,
          "aa_end": null,
          "aa_length": 1979,
          "cds_start": 3743,
          "cds_end": null,
          "cds_length": 5940,
          "cdna_start": 3919,
          "cdna_end": null,
          "cdna_length": 6901,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RVLGQAKQEVEHKKKKLEAQVQELQ",
          "aa_alt": "Q",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 28,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1241_Leu1264del",
          "transcript": "ENST00000713757.1",
          "protein_id": "ENSP00000519058.1",
          "transcript_support_level": null,
          "aa_start": 1241,
          "aa_end": null,
          "aa_length": 1972,
          "cds_start": 3722,
          "cds_end": null,
          "cds_length": 5919,
          "cdna_start": 4027,
          "cdna_end": null,
          "cdna_length": 7006,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "RVLGQAKQEVEHKKKKLEAQVQELQ",
          "aa_alt": "Q",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 28,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1241_Leu1264del",
          "transcript": "NM_022844.3",
          "protein_id": "NP_074035.1",
          "transcript_support_level": null,
          "aa_start": 1241,
          "aa_end": null,
          "aa_length": 1938,
          "cds_start": 3722,
          "cds_end": null,
          "cds_length": 5817,
          "cdna_start": 3898,
          "cdna_end": null,
          "cdna_length": 6919,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "ENSG00000263335",
          "gene_hgnc_id": null,
          "hgvs_c": "n.248_319delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000574212.1",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 836,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 29,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "n.*1905_*1976delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": null,
          "transcript": "ENST00000652121.1",
          "protein_id": "ENSP00000498314.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6126,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*1289_*1360delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000674538.1",
          "protein_id": "ENSP00000501547.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3241,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*2488_*2559delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000674588.1",
          "protein_id": "ENSP00000502802.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5693,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*2670_*2741delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000675951.1",
          "protein_id": "ENSP00000502160.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5861,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "c.*2488_*2559delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000674995.1",
          "protein_id": "ENSP00000502414.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 317,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 954,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5636,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 29,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "MYH11",
          "gene_hgnc_id": 7569,
          "hgvs_c": "n.*1905_*1976delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": null,
          "transcript": "ENST00000652121.1",
          "protein_id": "ENSP00000498314.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6126,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*1289_*1360delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000674538.1",
          "protein_id": "ENSP00000501547.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3241,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*2488_*2559delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000674588.1",
          "protein_id": "ENSP00000502802.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5693,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*2670_*2741delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000675951.1",
          "protein_id": "ENSP00000502160.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5861,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": 10,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*868+1802_*868+1873delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000674554.1",
          "protein_id": "ENSP00000502635.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2530,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 9,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*868+1802_*868+1873delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000674888.1",
          "protein_id": "ENSP00000501936.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2699,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": 8,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*1277+1802_*1277+1873delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000674900.1",
          "protein_id": "ENSP00000502662.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2313,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": 10,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*1628+1802_*1628+1873delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000675171.1",
          "protein_id": "ENSP00000501812.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2551,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": 10,
          "intron_rank_end": null,
          "gene_symbol": "NDE1",
          "gene_hgnc_id": 17619,
          "hgvs_c": "n.*868+1802_*868+1873delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null,
          "transcript": "ENST00000675926.1",
          "protein_id": "ENSP00000502354.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2550,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "MYH11",
      "gene_hgnc_id": 7569,
      "dbsnp": "rs1555554098",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 9.325,
      "phylop100way_prediction": "Pathogenic",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 4,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "PM4,PP3,PP5",
      "acmg_by_gene": [
        {
          "score": 4,
          "benign_score": 0,
          "pathogenic_score": 4,
          "criteria": [
            "PM4",
            "PP3",
            "PP5"
          ],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000300036.6",
          "gene_symbol": "MYH11",
          "hgnc_id": 7569,
          "effects": [
            "disruptive_inframe_deletion"
          ],
          "inheritance_mode": "AD,AR",
          "hgvs_c": "c.3722_3793delGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGC",
          "hgvs_p": "p.Arg1241_Leu1264del"
        },
        {
          "score": 2,
          "benign_score": 0,
          "pathogenic_score": 2,
          "criteria": [
            "PP3",
            "PP5"
          ],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000574212.1",
          "gene_symbol": "ENSG00000263335",
          "hgnc_id": null,
          "effects": [
            "non_coding_transcript_exon_variant"
          ],
          "inheritance_mode": "",
          "hgvs_c": "n.248_319delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null
        },
        {
          "score": 2,
          "benign_score": 0,
          "pathogenic_score": 2,
          "criteria": [
            "PP3",
            "PP5"
          ],
          "verdict": "Uncertain_significance",
          "transcript": "ENST00000674538.1",
          "gene_symbol": "NDE1",
          "hgnc_id": 17619,
          "effects": [
            "non_coding_transcript_exon_variant"
          ],
          "inheritance_mode": "AR,Unknown",
          "hgvs_c": "n.*1289_*1360delTGCACCTGCGCCTCCAGCTTCTTCTTCTTATGTTCCACCTCCTGCTTGGCCTGGCCCAGGACCCGCAGCTCC",
          "hgvs_p": null
        }
      ],
      "clinvar_disease": " familial thoracic 4,Aortic aneurysm",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "no assertion criteria provided",
      "clinvar_submissions_summary": "null",
      "phenotype_combined": "Aortic aneurysm, familial thoracic 4",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}