← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 16-2061962-AGGAGAGATACTTTGAACTGGT-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=16&pos=2061962&ref=AGGAGAGATACTTTGAACTGGT&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "16",
"pos": 2061962,
"ref": "AGGAGAGATACTTTGAACTGGT",
"alt": "A",
"effect": "disruptive_inframe_deletion",
"transcript": "ENST00000219476.9",
"consequences": [
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_000548.5",
"protein_id": "NP_000539.2",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1807,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5424,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6415,
"mane_select": "ENST00000219476.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000219476.9",
"protein_id": "ENSP00000219476.3",
"transcript_support_level": 5,
"aa_start": 407,
"aa_end": null,
"aa_length": 1807,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5424,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6415,
"mane_select": "NM_000548.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000350773.9",
"protein_id": "ENSP00000344383.4",
"transcript_support_level": 1,
"aa_start": 407,
"aa_end": null,
"aa_length": 1784,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5355,
"cdna_start": 1295,
"cdna_end": null,
"cdna_length": 5538,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000401874.7",
"protein_id": "ENSP00000384468.2",
"transcript_support_level": 1,
"aa_start": 407,
"aa_end": null,
"aa_length": 1740,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5223,
"cdna_start": 1326,
"cdna_end": null,
"cdna_length": 5437,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*519_*539delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000439117.6",
"protein_id": "ENSP00000406980.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5073,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*519_*539delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000439117.6",
"protein_id": "ENSP00000406980.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5073,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000645186.2",
"protein_id": "ENSP00000495110.2",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1837,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5514,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6505,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_001406663.1",
"protein_id": "NP_001393592.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1806,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5421,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6412,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000642365.2",
"protein_id": "ENSP00000495459.2",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1806,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5421,
"cdna_start": 1291,
"cdna_end": null,
"cdna_length": 5574,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000646388.1",
"protein_id": "ENSP00000495921.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1805,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5418,
"cdna_start": 1306,
"cdna_end": null,
"cdna_length": 5614,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_001114382.3",
"protein_id": "NP_001107854.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1784,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5355,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6346,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_001406664.1",
"protein_id": "NP_001393593.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1783,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5352,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6343,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000643946.1",
"protein_id": "ENSP00000495927.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1782,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5349,
"cdna_start": 1338,
"cdna_end": null,
"cdna_length": 6344,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_001406665.1",
"protein_id": "NP_001393594.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1781,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5346,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6337,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1211_1231delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr404_Arg410del",
"transcript": "ENST00000644399.1",
"protein_id": "ENSP00000493990.1",
"transcript_support_level": null,
"aa_start": 404,
"aa_end": null,
"aa_length": 1780,
"cds_start": 1211,
"cds_end": null,
"cds_length": 5343,
"cdna_start": 1213,
"cdna_end": null,
"cdna_length": 5445,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1310_1330delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr437_Arg443del",
"transcript": "NM_001406667.1",
"protein_id": "NP_001393596.1",
"transcript_support_level": null,
"aa_start": 437,
"aa_end": null,
"aa_length": 1771,
"cds_start": 1310,
"cds_end": null,
"cds_length": 5316,
"cdna_start": 1420,
"cdna_end": null,
"cdna_length": 6307,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1310_1330delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr437_Arg443del",
"transcript": "NM_001406668.1",
"protein_id": "NP_001393597.1",
"transcript_support_level": null,
"aa_start": 437,
"aa_end": null,
"aa_length": 1770,
"cds_start": 1310,
"cds_end": null,
"cds_length": 5313,
"cdna_start": 1420,
"cdna_end": null,
"cdna_length": 6304,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000644329.1",
"protein_id": "ENSP00000496611.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1769,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5310,
"cdna_start": 1282,
"cdna_end": null,
"cdna_length": 5453,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_021055.3",
"protein_id": "NP_066399.2",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1764,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5295,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6286,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000644043.1",
"protein_id": "ENSP00000496262.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1764,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5295,
"cdna_start": 1274,
"cdna_end": null,
"cdna_length": 5457,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_001370404.1",
"protein_id": "NP_001357333.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1763,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5292,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6283,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000642936.1",
"protein_id": "ENSP00000494514.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1763,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5292,
"cdna_start": 1329,
"cdna_end": null,
"cdna_length": 5507,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_001370405.1",
"protein_id": "NP_001357334.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1760,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5283,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6274,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000642561.1",
"protein_id": "ENSP00000495099.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1760,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5283,
"cdna_start": 1272,
"cdna_end": null,
"cdna_length": 5396,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1265_1285delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr422_Arg428del",
"transcript": "ENST00000642206.2",
"protein_id": "ENSP00000495146.2",
"transcript_support_level": null,
"aa_start": 422,
"aa_end": null,
"aa_length": 1756,
"cds_start": 1265,
"cds_end": null,
"cds_length": 5271,
"cdna_start": 1381,
"cdna_end": null,
"cdna_length": 5485,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1253_1273delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr418_Arg424del",
"transcript": "NM_001318832.2",
"protein_id": "NP_001305761.1",
"transcript_support_level": null,
"aa_start": 418,
"aa_end": null,
"aa_length": 1751,
"cds_start": 1253,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 1321,
"cdna_end": null,
"cdna_length": 6205,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1253_1273delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr418_Arg424del",
"transcript": "ENST00000568454.6",
"protein_id": "ENSP00000454487.1",
"transcript_support_level": 2,
"aa_start": 418,
"aa_end": null,
"aa_length": 1751,
"cds_start": 1253,
"cds_end": null,
"cds_length": 5256,
"cdna_start": 1321,
"cdna_end": null,
"cdna_length": 5429,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr370_Arg376del",
"transcript": "NM_001406670.1",
"protein_id": "NP_001393599.1",
"transcript_support_level": null,
"aa_start": 370,
"aa_end": null,
"aa_length": 1747,
"cds_start": 1109,
"cds_end": null,
"cds_length": 5244,
"cdna_start": 1219,
"cdna_end": null,
"cdna_length": 6235,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_001363528.2",
"protein_id": "NP_001350457.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1741,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5226,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6217,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000642797.1",
"protein_id": "ENSP00000493846.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1741,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5226,
"cdna_start": 1274,
"cdna_end": null,
"cdna_length": 5388,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "NM_001077183.3",
"protein_id": "NP_001070651.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1740,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5223,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6214,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000644335.1",
"protein_id": "ENSP00000496317.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1739,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5220,
"cdna_start": 1320,
"cdna_end": null,
"cdna_length": 5433,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "ENST00000643088.1",
"protein_id": "ENSP00000494747.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1738,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5217,
"cdna_start": 1338,
"cdna_end": null,
"cdna_length": 5970,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1208_1228delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr403_Arg409del",
"transcript": "NM_001406671.1",
"protein_id": "NP_001393600.1",
"transcript_support_level": null,
"aa_start": 403,
"aa_end": null,
"aa_length": 1737,
"cds_start": 1208,
"cds_end": null,
"cds_length": 5214,
"cdna_start": 1318,
"cdna_end": null,
"cdna_length": 6205,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1208_1228delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr403_Arg409del",
"transcript": "NM_001406673.1",
"protein_id": "NP_001393602.1",
"transcript_support_level": null,
"aa_start": 403,
"aa_end": null,
"aa_length": 1736,
"cds_start": 1208,
"cds_end": null,
"cds_length": 5211,
"cdna_start": 1318,
"cdna_end": null,
"cdna_length": 6202,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr358_Arg364del",
"transcript": "NM_001406675.1",
"protein_id": "NP_001393604.1",
"transcript_support_level": null,
"aa_start": 358,
"aa_end": null,
"aa_length": 1735,
"cds_start": 1073,
"cds_end": null,
"cds_length": 5208,
"cdna_start": 1163,
"cdna_end": null,
"cdna_length": 6179,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr358_Arg364del",
"transcript": "NM_001406676.1",
"protein_id": "NP_001393605.1",
"transcript_support_level": null,
"aa_start": 358,
"aa_end": null,
"aa_length": 1734,
"cds_start": 1073,
"cds_end": null,
"cds_length": 5205,
"cdna_start": 1163,
"cdna_end": null,
"cdna_length": 6176,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1163_1183delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr388_Arg394del",
"transcript": "NM_001406677.1",
"protein_id": "NP_001393606.1",
"transcript_support_level": null,
"aa_start": 388,
"aa_end": null,
"aa_length": 1721,
"cds_start": 1163,
"cds_end": null,
"cds_length": 5166,
"cdna_start": 1253,
"cdna_end": null,
"cdna_length": 6137,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr370_Arg376del",
"transcript": "NM_001318827.2",
"protein_id": "NP_001305756.1",
"transcript_support_level": null,
"aa_start": 370,
"aa_end": null,
"aa_length": 1704,
"cds_start": 1109,
"cds_end": null,
"cds_length": 5115,
"cdna_start": 1219,
"cdna_end": null,
"cdna_length": 6106,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr370_Arg376del",
"transcript": "ENST00000439673.6",
"protein_id": "ENSP00000399232.2",
"transcript_support_level": 2,
"aa_start": 370,
"aa_end": null,
"aa_length": 1704,
"cds_start": 1109,
"cds_end": null,
"cds_length": 5115,
"cdna_start": 1190,
"cdna_end": null,
"cdna_length": 5287,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr370_Arg376del",
"transcript": "NM_001406678.1",
"protein_id": "NP_001393607.1",
"transcript_support_level": null,
"aa_start": 370,
"aa_end": null,
"aa_length": 1703,
"cds_start": 1109,
"cds_end": null,
"cds_length": 5112,
"cdna_start": 1219,
"cdna_end": null,
"cdna_length": 6103,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr358_Arg364del",
"transcript": "NM_001318829.2",
"protein_id": "NP_001305758.1",
"transcript_support_level": null,
"aa_start": 358,
"aa_end": null,
"aa_length": 1692,
"cds_start": 1073,
"cds_end": null,
"cds_length": 5079,
"cdna_start": 1163,
"cdna_end": null,
"cdna_length": 6050,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr358_Arg364del",
"transcript": "ENST00000382538.10",
"protein_id": "ENSP00000371978.6",
"transcript_support_level": 2,
"aa_start": 358,
"aa_end": null,
"aa_length": 1692,
"cds_start": 1073,
"cds_end": null,
"cds_length": 5079,
"cdna_start": 1168,
"cdna_end": null,
"cdna_length": 5264,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr358_Arg364del",
"transcript": "NM_001406679.1",
"protein_id": "NP_001393608.1",
"transcript_support_level": null,
"aa_start": 358,
"aa_end": null,
"aa_length": 1691,
"cds_start": 1073,
"cds_end": null,
"cds_length": 5076,
"cdna_start": 1163,
"cdna_end": null,
"cdna_length": 6047,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr207_Arg213del",
"transcript": "NM_001406680.1",
"protein_id": "NP_001393609.1",
"transcript_support_level": null,
"aa_start": 207,
"aa_end": null,
"aa_length": 1607,
"cds_start": 620,
"cds_end": null,
"cds_length": 4824,
"cdna_start": 1546,
"cdna_end": null,
"cdna_length": 6631,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.758_778delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr253_Arg259del",
"transcript": "NM_001406681.1",
"protein_id": "NP_001393610.1",
"transcript_support_level": null,
"aa_start": 253,
"aa_end": null,
"aa_length": 1587,
"cds_start": 758,
"cds_end": null,
"cds_length": 4764,
"cdna_start": 1313,
"cdna_end": null,
"cdna_length": 6200,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr207_Arg213del",
"transcript": "NM_001406682.1",
"protein_id": "NP_001393611.1",
"transcript_support_level": null,
"aa_start": 207,
"aa_end": null,
"aa_length": 1584,
"cds_start": 620,
"cds_end": null,
"cds_length": 4755,
"cdna_start": 956,
"cdna_end": null,
"cdna_length": 5972,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr207_Arg213del",
"transcript": "NM_001406683.1",
"protein_id": "NP_001393612.1",
"transcript_support_level": null,
"aa_start": 207,
"aa_end": null,
"aa_length": 1584,
"cds_start": 620,
"cds_end": null,
"cds_length": 4755,
"cdna_start": 1546,
"cdna_end": null,
"cdna_length": 6562,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr207_Arg213del",
"transcript": "NM_001406684.1",
"protein_id": "NP_001393613.1",
"transcript_support_level": null,
"aa_start": 207,
"aa_end": null,
"aa_length": 1583,
"cds_start": 620,
"cds_end": null,
"cds_length": 4752,
"cdna_start": 956,
"cdna_end": null,
"cdna_length": 5969,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 38,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr207_Arg213del",
"transcript": "NM_001318831.2",
"protein_id": "NP_001305760.1",
"transcript_support_level": null,
"aa_start": 207,
"aa_end": null,
"aa_length": 1563,
"cds_start": 620,
"cds_end": null,
"cds_length": 4692,
"cdna_start": 956,
"cdna_end": null,
"cdna_length": 5909,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 37,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr207_Arg213del",
"transcript": "NM_001406685.1",
"protein_id": "NP_001393614.1",
"transcript_support_level": null,
"aa_start": 207,
"aa_end": null,
"aa_length": 1541,
"cds_start": 620,
"cds_end": null,
"cds_length": 4626,
"cdna_start": 956,
"cdna_end": null,
"cdna_length": 5843,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 36,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr207_Arg213del",
"transcript": "NM_001406686.1",
"protein_id": "NP_001393615.1",
"transcript_support_level": null,
"aa_start": 207,
"aa_end": null,
"aa_length": 1541,
"cds_start": 620,
"cds_end": null,
"cds_length": 4626,
"cdna_start": 789,
"cdna_end": null,
"cdna_length": 5676,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr207_Arg213del",
"transcript": "NM_001406687.1",
"protein_id": "NP_001393616.1",
"transcript_support_level": null,
"aa_start": 207,
"aa_end": null,
"aa_length": 1540,
"cds_start": 620,
"cds_end": null,
"cds_length": 4623,
"cdna_start": 1546,
"cdna_end": null,
"cdna_length": 6430,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 37,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr207_Arg213del",
"transcript": "NM_001406688.1",
"protein_id": "NP_001393617.1",
"transcript_support_level": null,
"aa_start": 207,
"aa_end": null,
"aa_length": 1540,
"cds_start": 620,
"cds_end": null,
"cds_length": 4623,
"cdna_start": 956,
"cdna_end": null,
"cdna_length": 5840,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "XM_011522636.3",
"protein_id": "XP_011520938.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1825,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5478,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6469,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "XM_011522637.3",
"protein_id": "XP_011520939.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1824,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5475,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6466,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr370_Arg376del",
"transcript": "XM_011522638.3",
"protein_id": "XP_011520940.3",
"transcript_support_level": null,
"aa_start": 370,
"aa_end": null,
"aa_length": 1788,
"cds_start": 1109,
"cds_end": null,
"cds_length": 5367,
"cdna_start": 1219,
"cdna_end": null,
"cdna_length": 6358,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "YFELVERC",
"aa_alt": "C",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del",
"transcript": "XM_011522639.3",
"protein_id": "XP_011520941.1",
"transcript_support_level": null,
"aa_start": 407,
"aa_end": null,
"aa_length": 1782,
"cds_start": 1220,
"cds_end": null,
"cds_length": 5349,
"cdna_start": 1330,
"cdna_end": null,
"cdna_length": 6340,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.130_150delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000463601.2",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2529,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000568566.6",
"protein_id": "ENSP00000455997.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5350,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1265_1285delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000642812.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2320,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.3230_3250delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000643149.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4117,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*722_*742delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000643298.1",
"protein_id": "ENSP00000494393.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2963,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*152_*172delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000643745.1",
"protein_id": "ENSP00000495948.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2588,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000644135.1",
"protein_id": "ENSP00000495644.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2277,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1307_1327delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000644222.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2433,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*657_*677delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000644417.2",
"protein_id": "ENSP00000493912.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6666,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.2394_2414delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000644665.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3604,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.212_232delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000644847.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1735,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.2278_2298delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000645591.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3488,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*825_*845delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000646464.2",
"protein_id": "ENSP00000496610.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8598,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 30,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.233_253delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000646634.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4321,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.2978_2998delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000647234.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4228,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1888_1908delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000647242.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2749,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 39,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.2198_2218delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000715163.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6283,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1279_1299delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000715164.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2334,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NR_176225.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6257,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NR_176226.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6505,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NR_176227.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6433,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NR_176228.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6254,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NR_176229.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6179,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406689.1",
"protein_id": "NP_001393618.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1336,
"cds_start": -4,
"cds_end": null,
"cds_length": 4011,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6433,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406690.1",
"protein_id": "NP_001393619.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1316,
"cds_start": -4,
"cds_end": null,
"cds_length": 3951,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6373,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406691.1",
"protein_id": "NP_001393620.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1315,
"cds_start": -4,
"cds_end": null,
"cds_length": 3948,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6370,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406692.1",
"protein_id": "NP_001393621.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1293,
"cds_start": -4,
"cds_end": null,
"cds_length": 3882,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6304,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406693.1",
"protein_id": "NP_001393622.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1293,
"cds_start": -4,
"cds_end": null,
"cds_length": 3882,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6610,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-93_-73delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406694.1",
"protein_id": "NP_001393623.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1293,
"cds_start": -4,
"cds_end": null,
"cds_length": 3882,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6185,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-93_-73delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406695.1",
"protein_id": "NP_001393624.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1292,
"cds_start": -4,
"cds_end": null,
"cds_length": 3879,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6182,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406696.1",
"protein_id": "NP_001393625.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1292,
"cds_start": -4,
"cds_end": null,
"cds_length": 3879,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6289,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 41,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406697.1",
"protein_id": "NP_001393626.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1292,
"cds_start": -4,
"cds_end": null,
"cds_length": 3879,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6301,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 40,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "c.-301_-281delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "NM_001406698.1",
"protein_id": "NP_001393627.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1206,
"cds_start": -4,
"cds_end": null,
"cds_length": 3621,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6219,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*722_*742delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000643298.1",
"protein_id": "ENSP00000494393.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2963,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 13,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*152_*172delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000643745.1",
"protein_id": "ENSP00000495948.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2588,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 12,
"exon_rank_end": null,
"exon_count": 42,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*657_*677delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000644417.2",
"protein_id": "ENSP00000493912.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6666,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.*825_*845delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000646464.2",
"protein_id": "ENSP00000496610.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8598,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"hgvs_c": "n.428-526_428-506delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": null,
"transcript": "ENST00000467949.2",
"protein_id": null,
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 606,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "TSC2",
"gene_hgnc_id": 12363,
"dbsnp": "rs137853998",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 9.209,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 7,
"acmg_classification": "Likely_pathogenic",
"acmg_criteria": "PM1,PM4,PP3,PP5_Moderate",
"acmg_by_gene": [
{
"score": 7,
"benign_score": 0,
"pathogenic_score": 7,
"criteria": [
"PM1",
"PM4",
"PP3",
"PP5_Moderate"
],
"verdict": "Likely_pathogenic",
"transcript": "ENST00000219476.9",
"gene_symbol": "TSC2",
"hgnc_id": 12363,
"effects": [
"disruptive_inframe_deletion"
],
"inheritance_mode": "AD",
"hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
"hgvs_p": "p.Tyr407_Arg413del"
}
],
"clinvar_disease": "Tuberous sclerosis syndrome,not provided",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "P:1 O:1",
"phenotype_combined": "Tuberous sclerosis syndrome|not provided",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}