← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 16-2061962-AGGAGAGATACTTTGAACTGGT-A (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=16&pos=2061962&ref=AGGAGAGATACTTTGAACTGGT&alt=A&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "16",
      "pos": 2061962,
      "ref": "AGGAGAGATACTTTGAACTGGT",
      "alt": "A",
      "effect": "disruptive_inframe_deletion",
      "transcript": "ENST00000219476.9",
      "consequences": [
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_000548.5",
          "protein_id": "NP_000539.2",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1807,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5424,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6415,
          "mane_select": "ENST00000219476.9",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000219476.9",
          "protein_id": "ENSP00000219476.3",
          "transcript_support_level": 5,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1807,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5424,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6415,
          "mane_select": "NM_000548.5",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000350773.9",
          "protein_id": "ENSP00000344383.4",
          "transcript_support_level": 1,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1784,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5355,
          "cdna_start": 1295,
          "cdna_end": null,
          "cdna_length": 5538,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000401874.7",
          "protein_id": "ENSP00000384468.2",
          "transcript_support_level": 1,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1740,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5223,
          "cdna_start": 1326,
          "cdna_end": null,
          "cdna_length": 5437,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 38,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*519_*539delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000439117.6",
          "protein_id": "ENSP00000406980.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5073,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 38,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*519_*539delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000439117.6",
          "protein_id": "ENSP00000406980.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5073,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000645186.2",
          "protein_id": "ENSP00000495110.2",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1837,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5514,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6505,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_001406663.1",
          "protein_id": "NP_001393592.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1806,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5421,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6412,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000642365.2",
          "protein_id": "ENSP00000495459.2",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1806,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5421,
          "cdna_start": 1291,
          "cdna_end": null,
          "cdna_length": 5574,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000646388.1",
          "protein_id": "ENSP00000495921.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1805,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5418,
          "cdna_start": 1306,
          "cdna_end": null,
          "cdna_length": 5614,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_001114382.3",
          "protein_id": "NP_001107854.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1784,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5355,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6346,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_001406664.1",
          "protein_id": "NP_001393593.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1783,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5352,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6343,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000643946.1",
          "protein_id": "ENSP00000495927.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1782,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5349,
          "cdna_start": 1338,
          "cdna_end": null,
          "cdna_length": 6344,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_001406665.1",
          "protein_id": "NP_001393594.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1781,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5346,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6337,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1211_1231delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr404_Arg410del",
          "transcript": "ENST00000644399.1",
          "protein_id": "ENSP00000493990.1",
          "transcript_support_level": null,
          "aa_start": 404,
          "aa_end": null,
          "aa_length": 1780,
          "cds_start": 1211,
          "cds_end": null,
          "cds_length": 5343,
          "cdna_start": 1213,
          "cdna_end": null,
          "cdna_length": 5445,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1310_1330delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr437_Arg443del",
          "transcript": "NM_001406667.1",
          "protein_id": "NP_001393596.1",
          "transcript_support_level": null,
          "aa_start": 437,
          "aa_end": null,
          "aa_length": 1771,
          "cds_start": 1310,
          "cds_end": null,
          "cds_length": 5316,
          "cdna_start": 1420,
          "cdna_end": null,
          "cdna_length": 6307,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1310_1330delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr437_Arg443del",
          "transcript": "NM_001406668.1",
          "protein_id": "NP_001393597.1",
          "transcript_support_level": null,
          "aa_start": 437,
          "aa_end": null,
          "aa_length": 1770,
          "cds_start": 1310,
          "cds_end": null,
          "cds_length": 5313,
          "cdna_start": 1420,
          "cdna_end": null,
          "cdna_length": 6304,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000644329.1",
          "protein_id": "ENSP00000496611.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1769,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5310,
          "cdna_start": 1282,
          "cdna_end": null,
          "cdna_length": 5453,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_021055.3",
          "protein_id": "NP_066399.2",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1764,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5295,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6286,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000644043.1",
          "protein_id": "ENSP00000496262.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1764,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5295,
          "cdna_start": 1274,
          "cdna_end": null,
          "cdna_length": 5457,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_001370404.1",
          "protein_id": "NP_001357333.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1763,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5292,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6283,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000642936.1",
          "protein_id": "ENSP00000494514.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1763,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5292,
          "cdna_start": 1329,
          "cdna_end": null,
          "cdna_length": 5507,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_001370405.1",
          "protein_id": "NP_001357334.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1760,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5283,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6274,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000642561.1",
          "protein_id": "ENSP00000495099.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1760,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5283,
          "cdna_start": 1272,
          "cdna_end": null,
          "cdna_length": 5396,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1265_1285delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr422_Arg428del",
          "transcript": "ENST00000642206.2",
          "protein_id": "ENSP00000495146.2",
          "transcript_support_level": null,
          "aa_start": 422,
          "aa_end": null,
          "aa_length": 1756,
          "cds_start": 1265,
          "cds_end": null,
          "cds_length": 5271,
          "cdna_start": 1381,
          "cdna_end": null,
          "cdna_length": 5485,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1253_1273delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr418_Arg424del",
          "transcript": "NM_001318832.2",
          "protein_id": "NP_001305761.1",
          "transcript_support_level": null,
          "aa_start": 418,
          "aa_end": null,
          "aa_length": 1751,
          "cds_start": 1253,
          "cds_end": null,
          "cds_length": 5256,
          "cdna_start": 1321,
          "cdna_end": null,
          "cdna_length": 6205,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1253_1273delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr418_Arg424del",
          "transcript": "ENST00000568454.6",
          "protein_id": "ENSP00000454487.1",
          "transcript_support_level": 2,
          "aa_start": 418,
          "aa_end": null,
          "aa_length": 1751,
          "cds_start": 1253,
          "cds_end": null,
          "cds_length": 5256,
          "cdna_start": 1321,
          "cdna_end": null,
          "cdna_length": 5429,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr370_Arg376del",
          "transcript": "NM_001406670.1",
          "protein_id": "NP_001393599.1",
          "transcript_support_level": null,
          "aa_start": 370,
          "aa_end": null,
          "aa_length": 1747,
          "cds_start": 1109,
          "cds_end": null,
          "cds_length": 5244,
          "cdna_start": 1219,
          "cdna_end": null,
          "cdna_length": 6235,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_001363528.2",
          "protein_id": "NP_001350457.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1741,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5226,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6217,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000642797.1",
          "protein_id": "ENSP00000493846.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1741,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5226,
          "cdna_start": 1274,
          "cdna_end": null,
          "cdna_length": 5388,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "NM_001077183.3",
          "protein_id": "NP_001070651.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1740,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5223,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6214,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000644335.1",
          "protein_id": "ENSP00000496317.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1739,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5220,
          "cdna_start": 1320,
          "cdna_end": null,
          "cdna_length": 5433,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "ENST00000643088.1",
          "protein_id": "ENSP00000494747.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1738,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5217,
          "cdna_start": 1338,
          "cdna_end": null,
          "cdna_length": 5970,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1208_1228delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr403_Arg409del",
          "transcript": "NM_001406671.1",
          "protein_id": "NP_001393600.1",
          "transcript_support_level": null,
          "aa_start": 403,
          "aa_end": null,
          "aa_length": 1737,
          "cds_start": 1208,
          "cds_end": null,
          "cds_length": 5214,
          "cdna_start": 1318,
          "cdna_end": null,
          "cdna_length": 6205,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1208_1228delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr403_Arg409del",
          "transcript": "NM_001406673.1",
          "protein_id": "NP_001393602.1",
          "transcript_support_level": null,
          "aa_start": 403,
          "aa_end": null,
          "aa_length": 1736,
          "cds_start": 1208,
          "cds_end": null,
          "cds_length": 5211,
          "cdna_start": 1318,
          "cdna_end": null,
          "cdna_length": 6202,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr358_Arg364del",
          "transcript": "NM_001406675.1",
          "protein_id": "NP_001393604.1",
          "transcript_support_level": null,
          "aa_start": 358,
          "aa_end": null,
          "aa_length": 1735,
          "cds_start": 1073,
          "cds_end": null,
          "cds_length": 5208,
          "cdna_start": 1163,
          "cdna_end": null,
          "cdna_length": 6179,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr358_Arg364del",
          "transcript": "NM_001406676.1",
          "protein_id": "NP_001393605.1",
          "transcript_support_level": null,
          "aa_start": 358,
          "aa_end": null,
          "aa_length": 1734,
          "cds_start": 1073,
          "cds_end": null,
          "cds_length": 5205,
          "cdna_start": 1163,
          "cdna_end": null,
          "cdna_length": 6176,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1163_1183delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr388_Arg394del",
          "transcript": "NM_001406677.1",
          "protein_id": "NP_001393606.1",
          "transcript_support_level": null,
          "aa_start": 388,
          "aa_end": null,
          "aa_length": 1721,
          "cds_start": 1163,
          "cds_end": null,
          "cds_length": 5166,
          "cdna_start": 1253,
          "cdna_end": null,
          "cdna_length": 6137,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr370_Arg376del",
          "transcript": "NM_001318827.2",
          "protein_id": "NP_001305756.1",
          "transcript_support_level": null,
          "aa_start": 370,
          "aa_end": null,
          "aa_length": 1704,
          "cds_start": 1109,
          "cds_end": null,
          "cds_length": 5115,
          "cdna_start": 1219,
          "cdna_end": null,
          "cdna_length": 6106,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr370_Arg376del",
          "transcript": "ENST00000439673.6",
          "protein_id": "ENSP00000399232.2",
          "transcript_support_level": 2,
          "aa_start": 370,
          "aa_end": null,
          "aa_length": 1704,
          "cds_start": 1109,
          "cds_end": null,
          "cds_length": 5115,
          "cdna_start": 1190,
          "cdna_end": null,
          "cdna_length": 5287,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr370_Arg376del",
          "transcript": "NM_001406678.1",
          "protein_id": "NP_001393607.1",
          "transcript_support_level": null,
          "aa_start": 370,
          "aa_end": null,
          "aa_length": 1703,
          "cds_start": 1109,
          "cds_end": null,
          "cds_length": 5112,
          "cdna_start": 1219,
          "cdna_end": null,
          "cdna_length": 6103,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr358_Arg364del",
          "transcript": "NM_001318829.2",
          "protein_id": "NP_001305758.1",
          "transcript_support_level": null,
          "aa_start": 358,
          "aa_end": null,
          "aa_length": 1692,
          "cds_start": 1073,
          "cds_end": null,
          "cds_length": 5079,
          "cdna_start": 1163,
          "cdna_end": null,
          "cdna_length": 6050,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr358_Arg364del",
          "transcript": "ENST00000382538.10",
          "protein_id": "ENSP00000371978.6",
          "transcript_support_level": 2,
          "aa_start": 358,
          "aa_end": null,
          "aa_length": 1692,
          "cds_start": 1073,
          "cds_end": null,
          "cds_length": 5079,
          "cdna_start": 1168,
          "cdna_end": null,
          "cdna_length": 5264,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1073_1093delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr358_Arg364del",
          "transcript": "NM_001406679.1",
          "protein_id": "NP_001393608.1",
          "transcript_support_level": null,
          "aa_start": 358,
          "aa_end": null,
          "aa_length": 1691,
          "cds_start": 1073,
          "cds_end": null,
          "cds_length": 5076,
          "cdna_start": 1163,
          "cdna_end": null,
          "cdna_length": 6047,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr207_Arg213del",
          "transcript": "NM_001406680.1",
          "protein_id": "NP_001393609.1",
          "transcript_support_level": null,
          "aa_start": 207,
          "aa_end": null,
          "aa_length": 1607,
          "cds_start": 620,
          "cds_end": null,
          "cds_length": 4824,
          "cdna_start": 1546,
          "cdna_end": null,
          "cdna_length": 6631,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.758_778delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr253_Arg259del",
          "transcript": "NM_001406681.1",
          "protein_id": "NP_001393610.1",
          "transcript_support_level": null,
          "aa_start": 253,
          "aa_end": null,
          "aa_length": 1587,
          "cds_start": 758,
          "cds_end": null,
          "cds_length": 4764,
          "cdna_start": 1313,
          "cdna_end": null,
          "cdna_length": 6200,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 38,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr207_Arg213del",
          "transcript": "NM_001406682.1",
          "protein_id": "NP_001393611.1",
          "transcript_support_level": null,
          "aa_start": 207,
          "aa_end": null,
          "aa_length": 1584,
          "cds_start": 620,
          "cds_end": null,
          "cds_length": 4755,
          "cdna_start": 956,
          "cdna_end": null,
          "cdna_length": 5972,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr207_Arg213del",
          "transcript": "NM_001406683.1",
          "protein_id": "NP_001393612.1",
          "transcript_support_level": null,
          "aa_start": 207,
          "aa_end": null,
          "aa_length": 1584,
          "cds_start": 620,
          "cds_end": null,
          "cds_length": 4755,
          "cdna_start": 1546,
          "cdna_end": null,
          "cdna_length": 6562,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 38,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr207_Arg213del",
          "transcript": "NM_001406684.1",
          "protein_id": "NP_001393613.1",
          "transcript_support_level": null,
          "aa_start": 207,
          "aa_end": null,
          "aa_length": 1583,
          "cds_start": 620,
          "cds_end": null,
          "cds_length": 4752,
          "cdna_start": 956,
          "cdna_end": null,
          "cdna_length": 5969,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 38,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr207_Arg213del",
          "transcript": "NM_001318831.2",
          "protein_id": "NP_001305760.1",
          "transcript_support_level": null,
          "aa_start": 207,
          "aa_end": null,
          "aa_length": 1563,
          "cds_start": 620,
          "cds_end": null,
          "cds_length": 4692,
          "cdna_start": 956,
          "cdna_end": null,
          "cdna_length": 5909,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 37,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr207_Arg213del",
          "transcript": "NM_001406685.1",
          "protein_id": "NP_001393614.1",
          "transcript_support_level": null,
          "aa_start": 207,
          "aa_end": null,
          "aa_length": 1541,
          "cds_start": 620,
          "cds_end": null,
          "cds_length": 4626,
          "cdna_start": 956,
          "cdna_end": null,
          "cdna_length": 5843,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 36,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr207_Arg213del",
          "transcript": "NM_001406686.1",
          "protein_id": "NP_001393615.1",
          "transcript_support_level": null,
          "aa_start": 207,
          "aa_end": null,
          "aa_length": 1541,
          "cds_start": 620,
          "cds_end": null,
          "cds_length": 4626,
          "cdna_start": 789,
          "cdna_end": null,
          "cdna_length": 5676,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr207_Arg213del",
          "transcript": "NM_001406687.1",
          "protein_id": "NP_001393616.1",
          "transcript_support_level": null,
          "aa_start": 207,
          "aa_end": null,
          "aa_length": 1540,
          "cds_start": 620,
          "cds_end": null,
          "cds_length": 4623,
          "cdna_start": 1546,
          "cdna_end": null,
          "cdna_length": 6430,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 37,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.620_640delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr207_Arg213del",
          "transcript": "NM_001406688.1",
          "protein_id": "NP_001393617.1",
          "transcript_support_level": null,
          "aa_start": 207,
          "aa_end": null,
          "aa_length": 1540,
          "cds_start": 620,
          "cds_end": null,
          "cds_length": 4623,
          "cdna_start": 956,
          "cdna_end": null,
          "cdna_length": 5840,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "XM_011522636.3",
          "protein_id": "XP_011520938.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1825,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5478,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6469,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "XM_011522637.3",
          "protein_id": "XP_011520939.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1824,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5475,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6466,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1109_1129delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr370_Arg376del",
          "transcript": "XM_011522638.3",
          "protein_id": "XP_011520940.3",
          "transcript_support_level": null,
          "aa_start": 370,
          "aa_end": null,
          "aa_length": 1788,
          "cds_start": 1109,
          "cds_end": null,
          "cds_length": 5367,
          "cdna_start": 1219,
          "cdna_end": null,
          "cdna_length": 6358,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "YFELVERC",
          "aa_alt": "C",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "disruptive_inframe_deletion"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del",
          "transcript": "XM_011522639.3",
          "protein_id": "XP_011520941.1",
          "transcript_support_level": null,
          "aa_start": 407,
          "aa_end": null,
          "aa_length": 1782,
          "cds_start": 1220,
          "cds_end": null,
          "cds_length": 5349,
          "cdna_start": 1330,
          "cdna_end": null,
          "cdna_length": 6340,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.130_150delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000463601.2",
          "protein_id": null,
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2529,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000568566.6",
          "protein_id": "ENSP00000455997.2",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5350,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1265_1285delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000642812.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2320,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 10,
          "exon_rank_end": null,
          "exon_count": 13,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.3230_3250delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000643149.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4117,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 24,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*722_*742delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000643298.1",
          "protein_id": "ENSP00000494393.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2963,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*152_*172delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000643745.1",
          "protein_id": "ENSP00000495948.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2588,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 19,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000644135.1",
          "protein_id": "ENSP00000495644.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2277,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1307_1327delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000644222.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2433,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*657_*677delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000644417.2",
          "protein_id": "ENSP00000493912.2",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6666,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 14,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.2394_2414delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000644665.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3604,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.212_232delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000644847.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1735,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.2278_2298delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000645591.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3488,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 35,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*825_*845delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000646464.2",
          "protein_id": "ENSP00000496610.2",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 8598,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 30,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.233_253delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000646634.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4321,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.2978_2998delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000647234.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4228,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1888_1908delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000647242.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2749,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 11,
          "exon_rank_end": null,
          "exon_count": 39,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.2198_2218delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000715163.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6283,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 15,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1279_1299delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000715164.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2334,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NR_176225.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6257,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NR_176226.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6505,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NR_176227.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6433,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NR_176228.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6254,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.1330_1350delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NR_176229.1",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6179,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406689.1",
          "protein_id": "NP_001393618.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1336,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 4011,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6433,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406690.1",
          "protein_id": "NP_001393619.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1316,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3951,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6373,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406691.1",
          "protein_id": "NP_001393620.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1315,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3948,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6370,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406692.1",
          "protein_id": "NP_001393621.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1293,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3882,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6304,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406693.1",
          "protein_id": "NP_001393622.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1293,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3882,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6610,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-93_-73delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406694.1",
          "protein_id": "NP_001393623.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1293,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3882,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6185,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-93_-73delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406695.1",
          "protein_id": "NP_001393624.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1292,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3879,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6182,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406696.1",
          "protein_id": "NP_001393625.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1292,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3879,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6289,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 41,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-125_-105delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406697.1",
          "protein_id": "NP_001393626.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1292,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3879,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6301,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 40,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "c.-301_-281delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "NM_001406698.1",
          "protein_id": "NP_001393627.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 1206,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 3621,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6219,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 24,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*722_*742delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000643298.1",
          "protein_id": "ENSP00000494393.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2963,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 13,
          "exon_rank_end": null,
          "exon_count": 16,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*152_*172delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000643745.1",
          "protein_id": "ENSP00000495948.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2588,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 12,
          "exon_rank_end": null,
          "exon_count": 42,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*657_*677delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000644417.2",
          "protein_id": "ENSP00000493912.2",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 6666,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 35,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.*825_*845delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000646464.2",
          "protein_id": "ENSP00000496610.2",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 8598,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "TSC2",
          "gene_hgnc_id": 12363,
          "hgvs_c": "n.428-526_428-506delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": null,
          "transcript": "ENST00000467949.2",
          "protein_id": null,
          "transcript_support_level": 4,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 606,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "TSC2",
      "gene_hgnc_id": 12363,
      "dbsnp": "rs137853998",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 9.209,
      "phylop100way_prediction": "Pathogenic",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 7,
      "acmg_classification": "Likely_pathogenic",
      "acmg_criteria": "PM1,PM4,PP3,PP5_Moderate",
      "acmg_by_gene": [
        {
          "score": 7,
          "benign_score": 0,
          "pathogenic_score": 7,
          "criteria": [
            "PM1",
            "PM4",
            "PP3",
            "PP5_Moderate"
          ],
          "verdict": "Likely_pathogenic",
          "transcript": "ENST00000219476.9",
          "gene_symbol": "TSC2",
          "hgnc_id": 12363,
          "effects": [
            "disruptive_inframe_deletion"
          ],
          "inheritance_mode": "AD",
          "hgvs_c": "c.1220_1240delACTTTGAACTGGTGGAGAGAT",
          "hgvs_p": "p.Tyr407_Arg413del"
        }
      ],
      "clinvar_disease": "Tuberous sclerosis syndrome,not provided",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "P:1 O:1",
      "phenotype_combined": "Tuberous sclerosis syndrome|not provided",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}