← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 16-87604287-C-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=16&pos=87604287&ref=C&alt=CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG&genome=hg38&allGenes=true"
API Response
json
{
"variants": [
{
"chr": "16",
"pos": 87604287,
"ref": "C",
"alt": "CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG",
"effect": "intron_variant",
"transcript": "ENST00000284262.3",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "JPH3",
"gene_hgnc_id": 14203,
"hgvs_c": "n.732_733insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG",
"hgvs_p": null,
"transcript": "ENST00000301008.5",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1030,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "JPH3",
"gene_hgnc_id": 14203,
"hgvs_c": "c.382+801_382+802insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG",
"hgvs_p": null,
"transcript": "NM_020655.4",
"protein_id": "NP_065706.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 748,
"cds_start": -4,
"cds_end": null,
"cds_length": 2247,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4382,
"mane_select": "ENST00000284262.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "JPH3",
"gene_hgnc_id": 14203,
"hgvs_c": "c.382+801_382+802insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG",
"hgvs_p": null,
"transcript": "ENST00000284262.3",
"protein_id": "ENSP00000284262.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 748,
"cds_start": -4,
"cds_end": null,
"cds_length": 2247,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4382,
"mane_select": "NM_020655.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "V",
"aa_alt": "AAAAAAAAAAAAAAAAAAAAAV",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "JPH3",
"gene_hgnc_id": 14203,
"hgvs_c": "c.472_473insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG",
"hgvs_p": "p.Ala157_Val158insAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAla",
"transcript": "NM_001271604.4",
"protein_id": "NP_001258533.1",
"transcript_support_level": null,
"aa_start": 158,
"aa_end": null,
"aa_length": 186,
"cds_start": 473,
"cds_end": null,
"cds_length": 561,
"cdna_start": 1112,
"cdna_end": null,
"cdna_length": 1410,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "JPH3",
"gene_hgnc_id": 14203,
"hgvs_c": "c.*170_*171insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG",
"hgvs_p": null,
"transcript": "NM_001271605.3",
"protein_id": "NP_001258534.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 150,
"cds_start": -4,
"cds_end": null,
"cds_length": 453,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1561,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "JPH3",
"gene_hgnc_id": 14203,
"hgvs_c": "n.96+2399_96+2400insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG",
"hgvs_p": null,
"transcript": "ENST00000537256.5",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2191,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "JPH3",
"gene_hgnc_id": 14203,
"hgvs_c": "n.96+2399_96+2400insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG",
"hgvs_p": null,
"transcript": "NR_073379.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2420,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "JPH3",
"gene_hgnc_id": 14203,
"dbsnp": "rs71156237",
"frequency_reference_population": 0.000006668534,
"hom_count_reference_population": 0,
"allele_count_reference_population": 1,
"gnomad_exomes_af": null,
"gnomad_genomes_af": 0.00000666853,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": 1,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.966,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000284262.3",
"gene_symbol": "JPH3",
"hgnc_id": 14203,
"effects": [
"intron_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.382+801_382+802insCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}