← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 19-39245644-C-CATATATATATATATATATAT (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=19&pos=39245644&ref=C&alt=CATATATATATATATATATAT&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "19",
      "pos": 39245644,
      "ref": "C",
      "alt": "CATATATATATATATATATAT",
      "effect": "",
      "transcript": null,
      "consequences": [],
      "gene_symbol": null,
      "gene_hgnc_id": null,
      "dbsnp": "rs67461793",
      "frequency_reference_population": 0.0002761026,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 38,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": 0.000276103,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": 38,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": 0,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 0.24,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 0,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "",
      "acmg_by_gene": [
        {
          "score": 0,
          "benign_score": 0,
          "pathogenic_score": 0,
          "criteria": [],
          "verdict": "Uncertain_significance",
          "transcript": "",
          "gene_symbol": null,
          "hgnc_id": null,
          "effects": null,
          "inheritance_mode": "",
          "hgvs_c": null,
          "hgvs_p": null
        }
      ],
      "clinvar_disease": "",
      "clinvar_classification": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "phenotype_combined": null,
      "pathogenicity_classification_combined": null,
      "custom_annotations": null
    }
  ],
  "message": null
}
For research and educational, non-commercial use only. Not for clinical or diagnostic use. GeneBe does not provide medical advice. Data use for AI modeling is prohibited: if used, the cost is $0.001 per byte of downloaded uncompressed data.