← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 19-42401821-CCCCCCGCAGCCCCCGTCTA-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=19&pos=42401821&ref=CCCCCCGCAGCCCCCGTCTA&alt=C&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "19",
"pos": 42401821,
"ref": "CCCCCCGCAGCCCCCGTCTA",
"alt": "C",
"effect": "frameshift_variant",
"transcript": "ENST00000244289.9",
"consequences": [
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.3203_3221delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val1068fs",
"transcript": "NM_005357.4",
"protein_id": "NP_005348.2",
"transcript_support_level": null,
"aa_start": 1068,
"aa_end": null,
"aa_length": 1076,
"cds_start": 3203,
"cds_end": null,
"cds_length": 3231,
"cdna_start": 3460,
"cdna_end": null,
"cdna_length": 3768,
"mane_select": "ENST00000244289.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.3203_3221delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val1068fs",
"transcript": "ENST00000244289.9",
"protein_id": "ENSP00000244289.3",
"transcript_support_level": 1,
"aa_start": 1068,
"aa_end": null,
"aa_length": 1076,
"cds_start": 3203,
"cds_end": null,
"cds_length": 3231,
"cdna_start": 3460,
"cdna_end": null,
"cdna_length": 3768,
"mane_select": "NM_005357.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.105+4616_105+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000594624.8",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1514,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.3227_3245delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val1076fs",
"transcript": "ENST00000599918.2",
"protein_id": "ENSP00000472218.2",
"transcript_support_level": 5,
"aa_start": 1076,
"aa_end": null,
"aa_length": 1084,
"cds_start": 3227,
"cds_end": null,
"cds_length": 3255,
"cdna_start": 3245,
"cdna_end": null,
"cdna_length": 3255,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2975_2993delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val992fs",
"transcript": "ENST00000597620.6",
"protein_id": "ENSP00000469545.2",
"transcript_support_level": 3,
"aa_start": 992,
"aa_end": null,
"aa_length": 1000,
"cds_start": 2975,
"cds_end": null,
"cds_length": 3003,
"cdna_start": 2993,
"cdna_end": null,
"cdna_length": 3318,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2453_2471delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val818fs",
"transcript": "NM_001416100.1",
"protein_id": "NP_001403029.1",
"transcript_support_level": null,
"aa_start": 818,
"aa_end": null,
"aa_length": 826,
"cds_start": 2453,
"cds_end": null,
"cds_length": 2481,
"cdna_start": 2520,
"cdna_end": null,
"cdna_length": 2828,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2438_2456delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val813fs",
"transcript": "NM_001416101.1",
"protein_id": "NP_001403030.1",
"transcript_support_level": null,
"aa_start": 813,
"aa_end": null,
"aa_length": 821,
"cds_start": 2438,
"cds_end": null,
"cds_length": 2466,
"cdna_start": 2505,
"cdna_end": null,
"cdna_length": 2813,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2333_2351delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val778fs",
"transcript": "NM_001416102.1",
"protein_id": "NP_001403031.1",
"transcript_support_level": null,
"aa_start": 778,
"aa_end": null,
"aa_length": 786,
"cds_start": 2333,
"cds_end": null,
"cds_length": 2361,
"cdna_start": 2387,
"cdna_end": null,
"cdna_length": 2695,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2300_2318delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val767fs",
"transcript": "NM_001416103.1",
"protein_id": "NP_001403032.1",
"transcript_support_level": null,
"aa_start": 767,
"aa_end": null,
"aa_length": 775,
"cds_start": 2300,
"cds_end": null,
"cds_length": 2328,
"cdna_start": 2478,
"cdna_end": null,
"cdna_length": 2786,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2300_2318delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val767fs",
"transcript": "NM_001416104.1",
"protein_id": "NP_001403033.1",
"transcript_support_level": null,
"aa_start": 767,
"aa_end": null,
"aa_length": 775,
"cds_start": 2300,
"cds_end": null,
"cds_length": 2328,
"cdna_start": 2483,
"cdna_end": null,
"cdna_length": 2791,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2210_2228delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val737fs",
"transcript": "NM_001416105.1",
"protein_id": "NP_001403034.1",
"transcript_support_level": null,
"aa_start": 737,
"aa_end": null,
"aa_length": 745,
"cds_start": 2210,
"cds_end": null,
"cds_length": 2238,
"cdna_start": 2277,
"cdna_end": null,
"cdna_length": 2585,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2105_2123delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val702fs",
"transcript": "NM_001416106.1",
"protein_id": "NP_001403035.1",
"transcript_support_level": null,
"aa_start": 702,
"aa_end": null,
"aa_length": 710,
"cds_start": 2105,
"cds_end": null,
"cds_length": 2133,
"cdna_start": 2159,
"cdna_end": null,
"cdna_length": 2467,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.1616_1634delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val539fs",
"transcript": "NM_001416107.1",
"protein_id": "NP_001403036.1",
"transcript_support_level": null,
"aa_start": 539,
"aa_end": null,
"aa_length": 547,
"cds_start": 1616,
"cds_end": null,
"cds_length": 1644,
"cdna_start": 1741,
"cdna_end": null,
"cdna_length": 2049,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.1562_1580delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val521fs",
"transcript": "NM_001416108.1",
"protein_id": "NP_001403037.1",
"transcript_support_level": null,
"aa_start": 521,
"aa_end": null,
"aa_length": 529,
"cds_start": 1562,
"cds_end": null,
"cds_length": 1590,
"cdna_start": 2663,
"cdna_end": null,
"cdna_length": 2971,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2975_2993delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val992fs",
"transcript": "XM_005258937.4",
"protein_id": "XP_005258994.1",
"transcript_support_level": null,
"aa_start": 992,
"aa_end": null,
"aa_length": 1000,
"cds_start": 2975,
"cds_end": null,
"cds_length": 3003,
"cdna_start": 3232,
"cdna_end": null,
"cdna_length": 3540,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 11,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2489_2507delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val830fs",
"transcript": "XM_005258939.4",
"protein_id": "XP_005258996.2",
"transcript_support_level": null,
"aa_start": 830,
"aa_end": null,
"aa_length": 838,
"cds_start": 2489,
"cds_end": null,
"cds_length": 2517,
"cdna_start": 2522,
"cdna_end": null,
"cdna_length": 2830,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2300_2318delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val767fs",
"transcript": "XM_006723218.4",
"protein_id": "XP_006723281.1",
"transcript_support_level": null,
"aa_start": 767,
"aa_end": null,
"aa_length": 775,
"cds_start": 2300,
"cds_end": null,
"cds_length": 2328,
"cdna_start": 2623,
"cdna_end": null,
"cdna_length": 2931,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2300_2318delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val767fs",
"transcript": "XM_047438835.1",
"protein_id": "XP_047294791.1",
"transcript_support_level": null,
"aa_start": 767,
"aa_end": null,
"aa_length": 775,
"cds_start": 2300,
"cds_end": null,
"cds_length": 2328,
"cdna_start": 2554,
"cdna_end": null,
"cdna_length": 2862,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "VDGGCGG",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 10,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"hgvs_c": "c.2261_2279delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val754fs",
"transcript": "XM_047438836.1",
"protein_id": "XP_047294792.1",
"transcript_support_level": null,
"aa_start": 754,
"aa_end": null,
"aa_length": 762,
"cds_start": 2261,
"cds_end": null,
"cds_length": 2289,
"cdna_start": 2294,
"cdna_end": null,
"cdna_length": 2602,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.124_142delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750195.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 488,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.87_105delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750196.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 412,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.-6_13delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750197.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 399,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.130+4616_130+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000593491.4",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 337,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.77+4616_77+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000597203.2",
"protein_id": null,
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1094,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.124+193_124+211delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000599276.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 315,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.297+480_297+498delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000685146.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 484,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.121+4616_121+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000685574.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 983,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.106+4616_106+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000689053.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1097,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.110+4616_110+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000701294.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 671,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.118+4616_118+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000702399.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 607,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.55+4616_55+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750098.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 710,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.63+4616_63+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750099.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 493,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.61+4616_61+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750100.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 629,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.79+4616_79+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750102.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1210,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.66+4616_66+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750103.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1424,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.54+4616_54+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750104.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1700,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.51+4616_51+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750105.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1343,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.77+4616_77+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750106.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 695,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.75+4616_75+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750107.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 817,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.77+4616_77+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750113.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 977,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.109+4616_109+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750115.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 709,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.77+4616_77+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750116.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 636,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.66+4616_66+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750117.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 890,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.105+4616_105+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750119.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 670,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.107+4616_107+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750120.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 841,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.70+4616_70+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750121.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 915,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.66+4616_66+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750122.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 761,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.63+4616_63+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750123.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 904,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.61+4616_61+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750124.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 868,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.102+4616_102+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750125.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 686,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.65+4616_65+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750126.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 540,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.101+4616_101+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750127.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 760,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.77+4616_77+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750128.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 924,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.66+4616_66+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750129.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 952,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.66+4616_66+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750130.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 514,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.66+4616_66+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750131.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 626,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.51+4616_51+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750132.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 881,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.75+4616_75+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750133.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 703,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.49+4616_49+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750134.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 675,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.51+4616_51+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750135.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 270,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.51+4616_51+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750136.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 597,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.95+4616_95+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750141.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 617,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.90+4616_90+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750142.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 539,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.66+4616_66+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750143.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 593,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.66+4616_66+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750144.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 953,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.63+4616_63+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750145.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 737,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.67+4616_67+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750146.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 620,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.57+4616_57+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750147.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 674,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.63+4616_63+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750149.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1121,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.67+4616_67+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750150.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 381,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.77+4616_77+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750151.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 749,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.56+4616_56+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750152.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 983,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.106+4616_106+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750153.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 689,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.176-6418_176-6400delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750186.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 361,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.267+1127_267+1145delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750189.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 458,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.252+480_252+498delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750190.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 439,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.215+1127_215+1145delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750191.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 398,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.145+480_145+498delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750192.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 331,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.178+1127_178+1145delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750193.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 363,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.842+480_842+498delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "ENST00000750194.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1025,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.77+4616_77+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "NR_073180.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1474,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LOC101930071",
"gene_hgnc_id": null,
"hgvs_c": "n.97+4616_97+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null,
"transcript": "NR_126041.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 292,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.-24_-6delCCCCCGCAGCCCCCGTCTA",
"hgvs_p": null,
"transcript": "ENST00000750197.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 399,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LIPE-AS1",
"gene_hgnc_id": 48589,
"hgvs_c": "n.-143_-125delCCCCCGCAGCCCCCGTCTA",
"hgvs_p": null,
"transcript": "ENST00000750198.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 440,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "LIPE",
"gene_hgnc_id": 6621,
"dbsnp": "rs587777699",
"frequency_reference_population": 0.0005662738,
"hom_count_reference_population": 0,
"allele_count_reference_population": 86,
"gnomad_exomes_af": 0.000467051,
"gnomad_genomes_af": 0.000566274,
"gnomad_exomes_ac": 620,
"gnomad_genomes_ac": 86,
"gnomad_exomes_homalt": 1,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.871,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 3,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PVS1_Moderate,PP5",
"acmg_by_gene": [
{
"score": 3,
"benign_score": 0,
"pathogenic_score": 3,
"criteria": [
"PVS1_Moderate",
"PP5"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000244289.9",
"gene_symbol": "LIPE",
"hgnc_id": 6621,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.3203_3221delTAGACGGGGGCTGCGGGGG",
"hgvs_p": "p.Val1068fs"
},
{
"score": 1,
"benign_score": 0,
"pathogenic_score": 1,
"criteria": [
"PP5"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000750195.1",
"gene_symbol": "LIPE-AS1",
"hgnc_id": 48589,
"effects": [
"non_coding_transcript_exon_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.124_142delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null
},
{
"score": 1,
"benign_score": 0,
"pathogenic_score": 1,
"criteria": [
"PP5"
],
"verdict": "Uncertain_significance",
"transcript": "NR_126041.1",
"gene_symbol": "LOC101930071",
"hgnc_id": null,
"effects": [
"intron_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.97+4616_97+4634delACCCCCGCAGCCCCCGTCT",
"hgvs_p": null
}
],
"clinvar_disease": "LIPE-related disorder,LIPE-related familial partial lipodystrophy",
"clinvar_classification": "Conflicting classifications of pathogenicity",
"clinvar_review_status": "criteria provided, conflicting classifications",
"clinvar_submissions_summary": "P:1 LP:2 US:1",
"phenotype_combined": "LIPE-related familial partial lipodystrophy|LIPE-related disorder",
"pathogenicity_classification_combined": "Conflicting classifications of pathogenicity",
"custom_annotations": null
}
],
"message": null
}