← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 2-178677772-T-TTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTCC (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=178677772&ref=T&alt=TTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTCC&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "2",
"pos": 178677772,
"ref": "T",
"alt": "TTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTCC",
"effect": "disruptive_inframe_insertion",
"transcript": "ENST00000589042.5",
"consequences": [
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 146,
"exon_rank_end": null,
"exon_count": 363,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "NM_001267550.2",
"protein_id": "NP_001254479.2",
"transcript_support_level": null,
"aa_start": 11380,
"aa_end": null,
"aa_length": 35991,
"cds_start": 34139,
"cds_end": null,
"cds_length": 107976,
"cdna_start": 34364,
"cdna_end": null,
"cdna_length": 109224,
"mane_select": "ENST00000589042.5",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 146,
"exon_rank_end": null,
"exon_count": 363,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "ENST00000589042.5",
"protein_id": "ENSP00000467141.1",
"transcript_support_level": 5,
"aa_start": 11380,
"aa_end": null,
"aa_length": 35991,
"cds_start": 34139,
"cds_end": null,
"cds_length": 107976,
"cdna_start": 34364,
"cdna_end": null,
"cdna_length": 109224,
"mane_select": "NM_001267550.2",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 146,
"exon_rank_end": null,
"exon_count": 361,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "ENST00000446966.2",
"protein_id": "ENSP00000408004.2",
"transcript_support_level": 1,
"aa_start": 11380,
"aa_end": null,
"aa_length": 35939,
"cds_start": 34139,
"cds_end": null,
"cds_length": 107820,
"cdna_start": 34364,
"cdna_end": null,
"cdna_length": 109068,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 144,
"exon_rank_end": null,
"exon_count": 361,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.33822_33863dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11288_Glu11289insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "ENST00000436599.2",
"protein_id": "ENSP00000405517.2",
"transcript_support_level": 1,
"aa_start": 11288,
"aa_end": null,
"aa_length": 35899,
"cds_start": 33863,
"cds_end": null,
"cds_length": 107700,
"cdna_start": 34088,
"cdna_end": null,
"cdna_length": 108948,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 146,
"exon_rank_end": null,
"exon_count": 356,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "ENST00000426232.6",
"protein_id": "ENSP00000392336.2",
"transcript_support_level": 1,
"aa_start": 11380,
"aa_end": null,
"aa_length": 35805,
"cds_start": 34139,
"cds_end": null,
"cds_length": 107418,
"cdna_start": 34364,
"cdna_end": null,
"cdna_length": 108666,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 148,
"exon_rank_end": null,
"exon_count": 365,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "ENST00000412264.2",
"protein_id": "ENSP00000394672.2",
"transcript_support_level": 3,
"aa_start": 11380,
"aa_end": null,
"aa_length": 35991,
"cds_start": 34139,
"cds_end": null,
"cds_length": 107976,
"cdna_start": 34628,
"cdna_end": null,
"cdna_length": 109488,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 146,
"exon_rank_end": null,
"exon_count": 362,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "ENST00000425332.3",
"protein_id": "ENSP00000396805.3",
"transcript_support_level": 5,
"aa_start": 11380,
"aa_end": null,
"aa_length": 35963,
"cds_start": 34139,
"cds_end": null,
"cds_length": 107892,
"cdna_start": 34364,
"cdna_end": null,
"cdna_length": 109140,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 143,
"exon_rank_end": null,
"exon_count": 360,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.33684_33725dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11242_Glu11243insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "ENST00000715174.1",
"protein_id": "ENSP00000520370.1",
"transcript_support_level": null,
"aa_start": 11242,
"aa_end": null,
"aa_length": 35853,
"cds_start": 33725,
"cds_end": null,
"cds_length": 107562,
"cdna_start": 33950,
"cdna_end": null,
"cdna_length": 108810,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 144,
"exon_rank_end": null,
"exon_count": 313,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.33147_33188dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11063_Glu11064insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "NM_001256850.1",
"protein_id": "NP_001243779.1",
"transcript_support_level": null,
"aa_start": 11063,
"aa_end": null,
"aa_length": 34350,
"cds_start": 33188,
"cds_end": null,
"cds_length": 103053,
"cdna_start": 33413,
"cdna_end": null,
"cdna_length": 104301,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 144,
"exon_rank_end": null,
"exon_count": 313,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.33147_33188dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11063_Glu11064insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "ENST00000591111.5",
"protein_id": "ENSP00000465570.1",
"transcript_support_level": 5,
"aa_start": 11063,
"aa_end": null,
"aa_length": 34350,
"cds_start": 33188,
"cds_end": null,
"cds_length": 103053,
"cdna_start": 33413,
"cdna_end": null,
"cdna_length": 104301,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 143,
"exon_rank_end": null,
"exon_count": 312,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.30366_30407dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu10136_Glu10137insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "NM_133378.4",
"protein_id": "NP_596869.4",
"transcript_support_level": null,
"aa_start": 10136,
"aa_end": null,
"aa_length": 33423,
"cds_start": 30407,
"cds_end": null,
"cds_length": 100272,
"cdna_start": 30632,
"cdna_end": null,
"cdna_length": 101520,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 143,
"exon_rank_end": null,
"exon_count": 312,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.30366_30407dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu10136_Glu10137insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "ENST00000342992.11",
"protein_id": "ENSP00000343764.6",
"transcript_support_level": 5,
"aa_start": 10136,
"aa_end": null,
"aa_length": 33423,
"cds_start": 30407,
"cds_end": null,
"cds_length": 100272,
"cdna_start": 30632,
"cdna_end": null,
"cdna_length": 101520,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 144,
"exon_rank_end": null,
"exon_count": 359,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.33150_33191dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11064_Glu11065insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "XM_017004819.1",
"protein_id": "XP_016860308.1",
"transcript_support_level": null,
"aa_start": 11064,
"aa_end": null,
"aa_length": 35622,
"cds_start": 33191,
"cds_end": null,
"cds_length": 106869,
"cdna_start": 33416,
"cdna_end": null,
"cdna_length": 108117,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 143,
"exon_rank_end": null,
"exon_count": 336,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.30369_30410dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu10137_Glu10138insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "XM_017004820.1",
"protein_id": "XP_016860309.1",
"transcript_support_level": null,
"aa_start": 10137,
"aa_end": null,
"aa_length": 34088,
"cds_start": 30410,
"cds_end": null,
"cds_length": 102267,
"cdna_start": 30635,
"cdna_end": null,
"cdna_length": 103515,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "EEEEVLPEEEEVLPE",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 143,
"exon_rank_end": null,
"exon_count": 336,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.30366_30407dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu10136_Glu10137insGluGluGluValLeuProGluGluGluGluValLeuProGlu",
"transcript": "XM_017004821.1",
"protein_id": "XP_016860310.1",
"transcript_support_level": null,
"aa_start": 10136,
"aa_end": null,
"aa_length": 34087,
"cds_start": 30407,
"cds_end": null,
"cds_length": 102264,
"cdna_start": 30632,
"cdna_end": null,
"cdna_length": 103512,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 192,
"intron_rank": 47,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.13859-35497_13859-35456dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "NM_133437.4",
"protein_id": "NP_597681.4",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 27118,
"cds_start": -4,
"cds_end": null,
"cds_length": 81357,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 82605,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": 46,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.13859-35497_13859-35456dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "ENST00000342175.12",
"protein_id": "ENSP00000340554.6",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 27118,
"cds_start": -4,
"cds_end": null,
"cds_length": 81357,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 82380,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 192,
"intron_rank": 47,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.13658-35497_13658-35456dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "NM_133432.3",
"protein_id": "NP_597676.3",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 27051,
"cds_start": -4,
"cds_end": null,
"cds_length": 81156,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 82404,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": 46,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.13658-35497_13658-35456dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "ENST00000359218.11",
"protein_id": "ENSP00000352154.5",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 27051,
"cds_start": -4,
"cds_end": null,
"cds_length": 81156,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 82179,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": 46,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.13283-35497_13283-35456dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "NM_003319.4",
"protein_id": "NP_003310.4",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 26926,
"cds_start": -4,
"cds_end": null,
"cds_length": 80781,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 82029,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": 46,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.13283-35497_13283-35456dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "ENST00000460472.6",
"protein_id": "ENSP00000434586.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 26926,
"cds_start": -4,
"cds_end": null,
"cds_length": 80781,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 82029,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.125-35961_125-35920dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000431752.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 609,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.199-83147_199-83106dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000585451.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 949,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.782+119_782+160dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000589487.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1077,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.212-35961_212-35920dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000589830.1",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 287,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.684-56711_684-56670dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000590773.6",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2377,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.1403+1688_1403+1729dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000592600.6",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1748,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.520-35961_520-35920dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000592630.5",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 666,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.136-56711_136-56670dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000625480.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 633,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.394-35961_394-35920dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000625536.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 693,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.337-35961_337-35920dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000626117.2",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 572,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.416-56711_416-56670dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000653807.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3996,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.315-60141_315-60100dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000657023.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2491,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.503-56711_503-56670dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000659121.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6297,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.1749+33292_1749+33333dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000671355.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2244,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.517-35961_517-35920dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000702938.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1012,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "TTN-AS1",
"gene_hgnc_id": 44124,
"hgvs_c": "n.711-35961_711-35920dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "ENST00000768381.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1203,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 317,
"intron_rank": 143,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.33046+311_33046+352dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_047445660.1",
"protein_id": "XP_047301616.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 34326,
"cds_start": -4,
"cds_end": null,
"cds_length": 102981,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 104229,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 313,
"intron_rank": 143,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.33046+311_33046+352dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_047445661.1",
"protein_id": "XP_047301617.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 34214,
"cds_start": -4,
"cds_end": null,
"cds_length": 102645,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 103893,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 310,
"intron_rank": 143,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.33046+311_33046+352dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_024453095.1",
"protein_id": "XP_024308863.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 34137,
"cds_start": -4,
"cds_end": null,
"cds_length": 102414,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 103662,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 300,
"intron_rank": 137,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.32476+311_32476+352dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_047445663.1",
"protein_id": "XP_047301619.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 33839,
"cds_start": -4,
"cds_end": null,
"cds_length": 101520,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 102768,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 282,
"intron_rank": 133,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.32140+311_32140+352dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_047445665.1",
"protein_id": "XP_047301621.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 33319,
"cds_start": -4,
"cds_end": null,
"cds_length": 99960,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 101208,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 277,
"intron_rank": 126,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.31519+311_31519+352dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_047445668.1",
"protein_id": "XP_047301624.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 33178,
"cds_start": -4,
"cds_end": null,
"cds_length": 99537,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 100785,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 274,
"intron_rank": 128,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.31684+311_31684+352dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_017004822.1",
"protein_id": "XP_016860311.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 33101,
"cds_start": -4,
"cds_end": null,
"cds_length": 99306,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 100554,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 273,
"intron_rank": 126,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.31516+311_31516+352dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_024453097.1",
"protein_id": "XP_024308865.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 33062,
"cds_start": -4,
"cds_end": null,
"cds_length": 99189,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 100437,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 272,
"intron_rank": 125,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.31435+311_31435+352dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_024453098.1",
"protein_id": "XP_024308866.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 33035,
"cds_start": -4,
"cds_end": null,
"cds_length": 99108,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 100356,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 192,
"intron_rank": 47,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.13424-35497_13424-35456dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_017004823.1",
"protein_id": "XP_016860312.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 26973,
"cds_start": -4,
"cds_end": null,
"cds_length": 80922,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 82170,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 191,
"intron_rank": 47,
"intron_rank_end": null,
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"hgvs_c": "c.13424-35497_13424-35456dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": null,
"transcript": "XM_024453099.1",
"protein_id": "XP_024308867.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 26956,
"cds_start": -4,
"cds_end": null,
"cds_length": 80871,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 82119,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "LOC124906100",
"gene_hgnc_id": null,
"hgvs_c": "n.2185+33292_2185+33333dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null,
"transcript": "XR_007087318.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2677,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "TTN",
"gene_hgnc_id": 12403,
"dbsnp": "rs397517548",
"frequency_reference_population": 6.8644545e-7,
"hom_count_reference_population": 0,
"allele_count_reference_population": 1,
"gnomad_exomes_af": 6.86445e-7,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": 1,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.914,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 2,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "PM4",
"acmg_by_gene": [
{
"score": 2,
"benign_score": 0,
"pathogenic_score": 2,
"criteria": [
"PM4"
],
"verdict": "Uncertain_significance",
"transcript": "ENST00000589042.5",
"gene_symbol": "TTN",
"hgnc_id": 12403,
"effects": [
"disruptive_inframe_insertion"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.34098_34139dupGGAAGAGGAAGTTCTACCTGAGGAAGAGGAAGTTCTACCTGA",
"hgvs_p": "p.Glu11380_Glu11381insGluGluGluValLeuProGluGluGluGluValLeuProGlu"
},
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000431752.1",
"gene_symbol": "TTN-AS1",
"hgnc_id": 44124,
"effects": [
"intron_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.125-35961_125-35920dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null
},
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "XR_007087318.1",
"gene_symbol": "LOC124906100",
"hgnc_id": null,
"effects": [
"intron_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.2185+33292_2185+33333dupCTCAGGTAGAACTTCCTCTTCCTCAGGTAGAACTTCCTCTTC",
"hgvs_p": null
}
],
"clinvar_disease": "Autosomal recessive limb-girdle muscular dystrophy type 2J,Dilated cardiomyopathy 1G",
"clinvar_classification": "Uncertain significance",
"clinvar_review_status": "criteria provided, single submitter",
"clinvar_submissions_summary": "US:1",
"phenotype_combined": "Dilated cardiomyopathy 1G;Autosomal recessive limb-girdle muscular dystrophy type 2J",
"pathogenicity_classification_combined": "Uncertain significance",
"custom_annotations": null
}
],
"message": null
}