← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 2-203873327-CATATATATATATATATATATATATATATATATATATATAT-C (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=203873327&ref=CATATATATATATATATATATATATATATATATATATATAT&alt=C&genome=hg38&allGenes=true"

API Response

json
{
  "message": null,
  "variants": [
    {
      "acmg_by_gene": [
        {
          "benign_score": 8,
          "criteria": [
            "BS1",
            "BS2"
          ],
          "effects": [
            "3_prime_UTR_variant"
          ],
          "gene_symbol": "CTLA4",
          "hgnc_id": 2505,
          "hgvs_c": "c.*532_*571delATATATATATATATATATATATATATATATATATATATAT",
          "hgvs_p": null,
          "inheritance_mode": "AD,Unknown",
          "pathogenic_score": 0,
          "score": -8,
          "transcript": "NM_005214.5",
          "verdict": "Benign"
        }
      ],
      "acmg_classification": "Benign",
      "acmg_criteria": "BS1,BS2",
      "acmg_score": -8,
      "allele_count_reference_population": 133,
      "alphamissense_prediction": null,
      "alphamissense_score": null,
      "alt": "C",
      "apogee2_prediction": null,
      "apogee2_score": null,
      "bayesdelnoaf_prediction": null,
      "bayesdelnoaf_score": null,
      "chr": "2",
      "clinvar_classification": "",
      "clinvar_disease": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "computational_prediction_selected": null,
      "computational_score_selected": null,
      "computational_source_selected": null,
      "consequences": [
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 223,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1997,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 672,
          "cds_start": null,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_count": 4,
          "exon_rank": 4,
          "exon_rank_end": null,
          "feature": "NM_005214.5",
          "gene_hgnc_id": 2505,
          "gene_symbol": "CTLA4",
          "hgvs_c": "c.*532_*571delATATATATATATATATATATATATATATATATATATATAT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": "ENST00000648405.2",
          "protein_coding": true,
          "protein_id": "NP_005205.2",
          "strand": true,
          "transcript": "NM_005214.5",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 223,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": true,
          "cdna_end": null,
          "cdna_length": 1997,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 672,
          "cds_start": null,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_count": 4,
          "exon_rank": 4,
          "exon_rank_end": null,
          "feature": "ENST00000648405.2",
          "gene_hgnc_id": 2505,
          "gene_symbol": "CTLA4",
          "hgvs_c": "c.*532_*571delATATATATATATATATATATATATATATATATATATATAT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": "NM_005214.5",
          "protein_coding": true,
          "protein_id": "ENSP00000497102.1",
          "strand": true,
          "transcript": "ENST00000648405.2",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 247,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2039,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 744,
          "cds_start": null,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_count": 5,
          "exon_rank": 5,
          "exon_rank_end": null,
          "feature": "ENST00000696479.1",
          "gene_hgnc_id": 2505,
          "gene_symbol": "CTLA4",
          "hgvs_c": "c.*532_*571delATATATATATATATATATATATATATATATATATATATAT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000512655.1",
          "strand": true,
          "transcript": "ENST00000696479.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 174,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1887,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 525,
          "cds_start": null,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_count": 3,
          "exon_rank": 3,
          "exon_rank_end": null,
          "feature": "NM_001037631.3",
          "gene_hgnc_id": 2505,
          "gene_symbol": "CTLA4",
          "hgvs_c": "c.*569_*608delATATATATATATATATATATATATATATATATATATATAT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_001032720.1",
          "strand": true,
          "transcript": "NM_001037631.3",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 203,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 1168,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 612,
          "cds_start": null,
          "consequences": [
            "downstream_gene_variant"
          ],
          "exon_count": 4,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000696049.1",
          "gene_hgnc_id": 2505,
          "gene_symbol": "CTLA4",
          "hgvs_c": "c.*516_*555delATATATATATATATATATATATATATATATATATATATAT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000512353.1",
          "strand": true,
          "transcript": "ENST00000696049.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 874,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "downstream_gene_variant"
          ],
          "exon_count": 3,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000427473.3",
          "gene_hgnc_id": 2505,
          "gene_symbol": "CTLA4",
          "hgvs_c": "n.*238_*277delATATATATATATATATATATATATATATATATATATATAT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000427473.3",
          "transcript_support_level": 5
        }
      ],
      "custom_annotations": null,
      "dbscsnv_ada_prediction": null,
      "dbscsnv_ada_score": null,
      "dbsnp": "rs60872763",
      "effect": "3_prime_UTR_variant",
      "frequency_reference_population": 0.00072822446,
      "gene_hgnc_id": 2505,
      "gene_symbol": "CTLA4",
      "gnomad_exomes_ac": 98,
      "gnomad_exomes_af": 0.00161898,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_ac": 35,
      "gnomad_genomes_af": 0.000286641,
      "gnomad_genomes_homalt": 0,
      "gnomad_mito_heteroplasmic": null,
      "gnomad_mito_homoplasmic": null,
      "hom_count_reference_population": 0,
      "mitotip_prediction": null,
      "mitotip_score": null,
      "pathogenicity_classification_combined": null,
      "phenotype_combined": null,
      "phylop100way_prediction": "Benign",
      "phylop100way_score": 1.829,
      "pos": 203873327,
      "ref": "CATATATATATATATATATATATATATATATATATATATAT",
      "revel_prediction": null,
      "revel_score": null,
      "splice_prediction_selected": null,
      "splice_score_selected": null,
      "splice_source_selected": null,
      "spliceai_max_prediction": null,
      "spliceai_max_score": null,
      "transcript": "NM_005214.5"
    }
  ]
}
For research and educational, non-commercial use only. Not for clinical or diagnostic use. GeneBe does not provide medical advice. Data use for AI modeling is prohibited: if used, the cost is $0.001 per byte of downloaded uncompressed data.