← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 2-214745727-CTGTCAAACTCAGTATATTT-C (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=214745727&ref=CTGTCAAACTCAGTATATTT&alt=C&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "2",
      "pos": 214745727,
      "ref": "CTGTCAAACTCAGTATATTT",
      "alt": "C",
      "effect": "frameshift_variant",
      "transcript": "ENST00000260947.9",
      "consequences": [
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.1786_1804delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys596fs",
          "transcript": "NM_000465.4",
          "protein_id": "NP_000456.2",
          "transcript_support_level": null,
          "aa_start": 596,
          "aa_end": null,
          "aa_length": 777,
          "cds_start": 1786,
          "cds_end": null,
          "cds_length": 2334,
          "cdna_start": 1918,
          "cdna_end": null,
          "cdna_length": 5478,
          "mane_select": "ENST00000260947.9",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.1786_1804delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys596fs",
          "transcript": "ENST00000260947.9",
          "protein_id": "ENSP00000260947.4",
          "transcript_support_level": 1,
          "aa_start": 596,
          "aa_end": null,
          "aa_length": 777,
          "cds_start": 1786,
          "cds_end": null,
          "cds_length": 2334,
          "cdna_start": 1918,
          "cdna_end": null,
          "cdna_length": 5478,
          "mane_select": "NM_000465.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.1729_1747delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys577fs",
          "transcript": "ENST00000617164.5",
          "protein_id": "ENSP00000480470.1",
          "transcript_support_level": 1,
          "aa_start": 577,
          "aa_end": null,
          "aa_length": 758,
          "cds_start": 1729,
          "cds_end": null,
          "cds_length": 2277,
          "cdna_start": 1820,
          "cdna_end": null,
          "cdna_length": 2473,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.1378_1396delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys460fs",
          "transcript": "ENST00000613706.5",
          "protein_id": "ENSP00000484976.2",
          "transcript_support_level": 1,
          "aa_start": 460,
          "aa_end": null,
          "aa_length": 641,
          "cds_start": 1378,
          "cds_end": null,
          "cds_length": 1926,
          "cdna_start": 1510,
          "cdna_end": null,
          "cdna_length": 2131,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.376_394delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys126fs",
          "transcript": "ENST00000613374.5",
          "protein_id": "ENSP00000484464.1",
          "transcript_support_level": 1,
          "aa_start": 126,
          "aa_end": null,
          "aa_length": 307,
          "cds_start": 376,
          "cds_end": null,
          "cds_length": 924,
          "cdna_start": 467,
          "cdna_end": null,
          "cdna_length": 1111,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.*452_*470delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "ENST00000620057.4",
          "protein_id": "ENSP00000481988.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 127,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 384,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1456,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.365-15238_365-15220delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "ENST00000619009.5",
          "protein_id": "ENSP00000482293.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 264,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 795,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 946,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "n.159-15238_159-15220delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "ENST00000613192.2",
          "protein_id": "ENSP00000483275.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 703,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.1729_1747delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys577fs",
          "transcript": "NM_001282543.2",
          "protein_id": "NP_001269472.1",
          "transcript_support_level": null,
          "aa_start": 577,
          "aa_end": null,
          "aa_length": 758,
          "cds_start": 1729,
          "cds_end": null,
          "cds_length": 2277,
          "cdna_start": 1861,
          "cdna_end": null,
          "cdna_length": 5421,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.433_451delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys145fs",
          "transcript": "NM_001282545.2",
          "protein_id": "NP_001269474.1",
          "transcript_support_level": null,
          "aa_start": 145,
          "aa_end": null,
          "aa_length": 326,
          "cds_start": 433,
          "cds_end": null,
          "cds_length": 981,
          "cdna_start": 565,
          "cdna_end": null,
          "cdna_length": 4125,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.433_451delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys145fs",
          "transcript": "ENST00000421162.2",
          "protein_id": "ENSP00000392245.2",
          "transcript_support_level": 3,
          "aa_start": 145,
          "aa_end": null,
          "aa_length": 326,
          "cds_start": 433,
          "cds_end": null,
          "cds_length": 981,
          "cdna_start": 479,
          "cdna_end": null,
          "cdna_length": 1010,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 3,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.376_394delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys126fs",
          "transcript": "NM_001282548.2",
          "protein_id": "NP_001269477.1",
          "transcript_support_level": null,
          "aa_start": 126,
          "aa_end": null,
          "aa_length": 307,
          "cds_start": 376,
          "cds_end": null,
          "cds_length": 924,
          "cdna_start": 508,
          "cdna_end": null,
          "cdna_length": 4068,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.1885_1903delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys629fs",
          "transcript": "XM_017004613.2",
          "protein_id": "XP_016860102.1",
          "transcript_support_level": null,
          "aa_start": 629,
          "aa_end": null,
          "aa_length": 810,
          "cds_start": 1885,
          "cds_end": null,
          "cds_length": 2433,
          "cdna_start": 2017,
          "cdna_end": null,
          "cdna_length": 5577,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 9,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.1885_1903delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys629fs",
          "transcript": "XM_017004614.2",
          "protein_id": "XP_016860103.1",
          "transcript_support_level": null,
          "aa_start": 629,
          "aa_end": null,
          "aa_length": 675,
          "cds_start": 1885,
          "cds_end": null,
          "cds_length": 2028,
          "cdna_start": 2017,
          "cdna_end": null,
          "cdna_length": 3130,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "KYTEFDS",
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant"
          ],
          "exon_rank": 8,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.1786_1804delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys596fs",
          "transcript": "XM_047445350.1",
          "protein_id": "XP_047301306.1",
          "transcript_support_level": null,
          "aa_start": 596,
          "aa_end": null,
          "aa_length": 642,
          "cds_start": 1786,
          "cds_end": null,
          "cds_length": 1929,
          "cdna_start": 1918,
          "cdna_end": null,
          "cdna_length": 3031,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "n.*1406_*1424delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "ENST00000455743.5",
          "protein_id": "ENSP00000412186.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2261,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "n.141_159delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "ENST00000465841.1",
          "protein_id": null,
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 175,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "n.*1864_*1882delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "ENST00000650978.1",
          "protein_id": "ENSP00000498880.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3814,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "n.1751_1769delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "NR_104212.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5329,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 6,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "n.1694_1712delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "NR_104215.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 5272,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "n.950_968delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "NR_104216.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 4528,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "n.*1406_*1424delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "ENST00000455743.5",
          "protein_id": "ENSP00000412186.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2261,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "3_prime_UTR_variant"
          ],
          "exon_rank": 7,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "n.*1864_*1882delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "ENST00000650978.1",
          "protein_id": "ENSP00000498880.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3814,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "BARD1",
          "gene_hgnc_id": 952,
          "hgvs_c": "c.365-15238_365-15220delAAATATACTGAGTTTGACA",
          "hgvs_p": null,
          "transcript": "NM_001282549.2",
          "protein_id": "NP_001269478.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 264,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 795,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 3939,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "BARD1",
      "gene_hgnc_id": 952,
      "dbsnp": "rs1553615102",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 6.125,
      "phylop100way_prediction": "Uncertain_significance",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 16,
      "acmg_classification": "Pathogenic",
      "acmg_criteria": "PVS1,PP5_Very_Strong",
      "acmg_by_gene": [
        {
          "score": 16,
          "benign_score": 0,
          "pathogenic_score": 16,
          "criteria": [
            "PVS1",
            "PP5_Very_Strong"
          ],
          "verdict": "Pathogenic",
          "transcript": "ENST00000260947.9",
          "gene_symbol": "BARD1",
          "hgnc_id": 952,
          "effects": [
            "frameshift_variant"
          ],
          "inheritance_mode": "AD",
          "hgvs_c": "c.1786_1804delAAATATACTGAGTTTGACA",
          "hgvs_p": "p.Lys596fs"
        }
      ],
      "clinvar_disease": "Familial cancer of breast,Hereditary cancer-predisposing syndrome",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
      "clinvar_submissions_summary": "P:3",
      "phenotype_combined": "Familial cancer of breast|Hereditary cancer-predisposing syndrome",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}