← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 2-214745727-CTGTCAAACTCAGTATATTT-C (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=214745727&ref=CTGTCAAACTCAGTATATTT&alt=C&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "2",
"pos": 214745727,
"ref": "CTGTCAAACTCAGTATATTT",
"alt": "C",
"effect": "frameshift_variant",
"transcript": "ENST00000260947.9",
"consequences": [
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.1786_1804delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys596fs",
"transcript": "NM_000465.4",
"protein_id": "NP_000456.2",
"transcript_support_level": null,
"aa_start": 596,
"aa_end": null,
"aa_length": 777,
"cds_start": 1786,
"cds_end": null,
"cds_length": 2334,
"cdna_start": 1918,
"cdna_end": null,
"cdna_length": 5478,
"mane_select": "ENST00000260947.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.1786_1804delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys596fs",
"transcript": "ENST00000260947.9",
"protein_id": "ENSP00000260947.4",
"transcript_support_level": 1,
"aa_start": 596,
"aa_end": null,
"aa_length": 777,
"cds_start": 1786,
"cds_end": null,
"cds_length": 2334,
"cdna_start": 1918,
"cdna_end": null,
"cdna_length": 5478,
"mane_select": "NM_000465.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.1729_1747delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys577fs",
"transcript": "ENST00000617164.5",
"protein_id": "ENSP00000480470.1",
"transcript_support_level": 1,
"aa_start": 577,
"aa_end": null,
"aa_length": 758,
"cds_start": 1729,
"cds_end": null,
"cds_length": 2277,
"cdna_start": 1820,
"cdna_end": null,
"cdna_length": 2473,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.1378_1396delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys460fs",
"transcript": "ENST00000613706.5",
"protein_id": "ENSP00000484976.2",
"transcript_support_level": 1,
"aa_start": 460,
"aa_end": null,
"aa_length": 641,
"cds_start": 1378,
"cds_end": null,
"cds_length": 1926,
"cdna_start": 1510,
"cdna_end": null,
"cdna_length": 2131,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.376_394delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys126fs",
"transcript": "ENST00000613374.5",
"protein_id": "ENSP00000484464.1",
"transcript_support_level": 1,
"aa_start": 126,
"aa_end": null,
"aa_length": 307,
"cds_start": 376,
"cds_end": null,
"cds_length": 924,
"cdna_start": 467,
"cdna_end": null,
"cdna_length": 1111,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.*452_*470delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "ENST00000620057.4",
"protein_id": "ENSP00000481988.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 127,
"cds_start": -4,
"cds_end": null,
"cds_length": 384,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1456,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.365-15238_365-15220delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "ENST00000619009.5",
"protein_id": "ENSP00000482293.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 264,
"cds_start": -4,
"cds_end": null,
"cds_length": 795,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 946,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "n.159-15238_159-15220delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "ENST00000613192.2",
"protein_id": "ENSP00000483275.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 703,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.1729_1747delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys577fs",
"transcript": "NM_001282543.2",
"protein_id": "NP_001269472.1",
"transcript_support_level": null,
"aa_start": 577,
"aa_end": null,
"aa_length": 758,
"cds_start": 1729,
"cds_end": null,
"cds_length": 2277,
"cdna_start": 1861,
"cdna_end": null,
"cdna_length": 5421,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.433_451delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys145fs",
"transcript": "NM_001282545.2",
"protein_id": "NP_001269474.1",
"transcript_support_level": null,
"aa_start": 145,
"aa_end": null,
"aa_length": 326,
"cds_start": 433,
"cds_end": null,
"cds_length": 981,
"cdna_start": 565,
"cdna_end": null,
"cdna_length": 4125,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 4,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.433_451delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys145fs",
"transcript": "ENST00000421162.2",
"protein_id": "ENSP00000392245.2",
"transcript_support_level": 3,
"aa_start": 145,
"aa_end": null,
"aa_length": 326,
"cds_start": 433,
"cds_end": null,
"cds_length": 981,
"cdna_start": 479,
"cdna_end": null,
"cdna_length": 1010,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 3,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.376_394delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys126fs",
"transcript": "NM_001282548.2",
"protein_id": "NP_001269477.1",
"transcript_support_level": null,
"aa_start": 126,
"aa_end": null,
"aa_length": 307,
"cds_start": 376,
"cds_end": null,
"cds_length": 924,
"cdna_start": 508,
"cdna_end": null,
"cdna_length": 4068,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.1885_1903delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys629fs",
"transcript": "XM_017004613.2",
"protein_id": "XP_016860102.1",
"transcript_support_level": null,
"aa_start": 629,
"aa_end": null,
"aa_length": 810,
"cds_start": 1885,
"cds_end": null,
"cds_length": 2433,
"cdna_start": 2017,
"cdna_end": null,
"cdna_length": 5577,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 9,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.1885_1903delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys629fs",
"transcript": "XM_017004614.2",
"protein_id": "XP_016860103.1",
"transcript_support_level": null,
"aa_start": 629,
"aa_end": null,
"aa_length": 675,
"cds_start": 1885,
"cds_end": null,
"cds_length": 2028,
"cdna_start": 2017,
"cdna_end": null,
"cdna_length": 3130,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KYTEFDS",
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"frameshift_variant"
],
"exon_rank": 8,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.1786_1804delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys596fs",
"transcript": "XM_047445350.1",
"protein_id": "XP_047301306.1",
"transcript_support_level": null,
"aa_start": 596,
"aa_end": null,
"aa_length": 642,
"cds_start": 1786,
"cds_end": null,
"cds_length": 1929,
"cdna_start": 1918,
"cdna_end": null,
"cdna_length": 3031,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "n.*1406_*1424delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "ENST00000455743.5",
"protein_id": "ENSP00000412186.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2261,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 2,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "n.141_159delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "ENST00000465841.1",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 175,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "n.*1864_*1882delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "ENST00000650978.1",
"protein_id": "ENSP00000498880.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3814,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "n.1751_1769delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "NR_104212.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5329,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 6,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "n.1694_1712delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "NR_104215.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5272,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "n.950_968delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "NR_104216.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4528,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "n.*1406_*1424delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "ENST00000455743.5",
"protein_id": "ENSP00000412186.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2261,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 7,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "n.*1864_*1882delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "ENST00000650978.1",
"protein_id": "ENSP00000498880.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3814,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"hgvs_c": "c.365-15238_365-15220delAAATATACTGAGTTTGACA",
"hgvs_p": null,
"transcript": "NM_001282549.2",
"protein_id": "NP_001269478.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 264,
"cds_start": -4,
"cds_end": null,
"cds_length": 795,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3939,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "BARD1",
"gene_hgnc_id": 952,
"dbsnp": "rs1553615102",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 6.125,
"phylop100way_prediction": "Uncertain_significance",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 16,
"acmg_classification": "Pathogenic",
"acmg_criteria": "PVS1,PP5_Very_Strong",
"acmg_by_gene": [
{
"score": 16,
"benign_score": 0,
"pathogenic_score": 16,
"criteria": [
"PVS1",
"PP5_Very_Strong"
],
"verdict": "Pathogenic",
"transcript": "ENST00000260947.9",
"gene_symbol": "BARD1",
"hgnc_id": 952,
"effects": [
"frameshift_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.1786_1804delAAATATACTGAGTTTGACA",
"hgvs_p": "p.Lys596fs"
}
],
"clinvar_disease": "Familial cancer of breast,Hereditary cancer-predisposing syndrome",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
"clinvar_submissions_summary": "P:3",
"phenotype_combined": "Familial cancer of breast|Hereditary cancer-predisposing syndrome",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}