← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 2-232531264-G-GGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=232531264&ref=G&alt=GGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "2",
"pos": 232531264,
"ref": "G",
"alt": "GGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"effect": "intron_variant",
"transcript": "ENST00000258385.8",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"hgvs_c": "c.821-52_821-18dupGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null,
"transcript": "NM_000751.3",
"protein_id": "NP_000742.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 517,
"cds_start": -4,
"cds_end": null,
"cds_length": 1554,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2962,
"mane_select": "ENST00000258385.8",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"hgvs_c": "c.821-88_821-87insGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null,
"transcript": "ENST00000258385.8",
"protein_id": "ENSP00000258385.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 517,
"cds_start": -4,
"cds_end": null,
"cds_length": 1554,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2962,
"mane_select": "NM_000751.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"hgvs_c": "c.776-52_776-18dupGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null,
"transcript": "NM_001256657.2",
"protein_id": "NP_001243586.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 502,
"cds_start": -4,
"cds_end": null,
"cds_length": 1509,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2917,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"hgvs_c": "c.776-88_776-87insGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null,
"transcript": "ENST00000543200.5",
"protein_id": "ENSP00000438380.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 502,
"cds_start": -4,
"cds_end": null,
"cds_length": 1509,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2918,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"hgvs_c": "c.518-52_518-18dupGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null,
"transcript": "NM_001311196.2",
"protein_id": "NP_001298125.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 416,
"cds_start": -4,
"cds_end": null,
"cds_length": 1251,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2930,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"hgvs_c": "c.239-52_239-18dupGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null,
"transcript": "NM_001311195.2",
"protein_id": "NP_001298124.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 323,
"cds_start": -4,
"cds_end": null,
"cds_length": 972,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2651,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"hgvs_c": "n.510-88_510-87insGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null,
"transcript": "ENST00000412233.5",
"protein_id": "ENSP00000398143.1",
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 735,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"hgvs_c": "n.*3-88_*3-87insGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null,
"transcript": "ENST00000441621.6",
"protein_id": "ENSP00000408819.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3022,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"hgvs_c": "n.*462-88_*462-87insGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null,
"transcript": "ENST00000446616.1",
"protein_id": "ENSP00000410801.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1580,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "CHRND",
"gene_hgnc_id": 1965,
"dbsnp": "rs530117757",
"frequency_reference_population": 0.00008916358,
"hom_count_reference_population": 0,
"allele_count_reference_population": 85,
"gnomad_exomes_af": 0.0000835705,
"gnomad_genomes_af": 0.000118744,
"gnomad_exomes_ac": 67,
"gnomad_genomes_ac": 18,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.301,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000258385.8",
"gene_symbol": "CHRND",
"hgnc_id": 1965,
"effects": [
"intron_variant"
],
"inheritance_mode": "AR,AD",
"hgvs_c": "c.821-88_821-87insGGACCCTCTAGGACCGGTGCCCCAAGGTCACAGCT",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}