← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 2-27313032-GGCCTCTCTGGTGTTCCTGCAGACCCC-G (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=2&pos=27313032&ref=GGCCTCTCTGGTGTTCCTGCAGACCCC&alt=G&genome=hg38&allGenes=true"API Response
json
{
"message": null,
"variants": [
{
"acmg_by_gene": [
{
"benign_score": 0,
"criteria": [
"PVS1",
"PP5"
],
"effects": [
"frameshift_variant"
],
"gene_symbol": "MPV17",
"hgnc_id": 7224,
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"inheritance_mode": "AR",
"pathogenic_score": 9,
"score": 9,
"transcript": "NM_002437.5",
"verdict": "Likely_pathogenic"
}
],
"acmg_classification": "Likely_pathogenic",
"acmg_criteria": "PVS1,PP5",
"acmg_score": 9,
"allele_count_reference_population": 0,
"alphamissense_prediction": null,
"alphamissense_score": null,
"alt": "G",
"apogee2_prediction": null,
"apogee2_score": null,
"bayesdelnoaf_prediction": null,
"bayesdelnoaf_score": null,
"chr": "2",
"clinvar_classification": "Pathogenic",
"clinvar_disease": "Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)",
"clinvar_review_status": "no assertion criteria provided",
"clinvar_submissions_summary": "null",
"computational_prediction_selected": null,
"computational_score_selected": null,
"computational_source_selected": null,
"consequences": [
{
"aa_alt": null,
"aa_end": null,
"aa_length": 176,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1002,
"cdna_start": 198,
"cds_end": null,
"cds_length": 531,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "NM_002437.5",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": "ENST00000380044.6",
"protein_coding": true,
"protein_id": "NP_002428.1",
"strand": false,
"transcript": "NM_002437.5",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 176,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": true,
"cdna_end": null,
"cdna_length": 1002,
"cdna_start": 198,
"cds_end": null,
"cds_length": 531,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000380044.6",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": "NM_002437.5",
"protein_coding": true,
"protein_id": "ENSP00000369383.1",
"strand": false,
"transcript": "ENST00000380044.6",
"transcript_support_level": 1
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 176,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 998,
"cdna_start": 194,
"cds_end": null,
"cds_length": 531,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 7,
"exon_rank": 2,
"exon_rank_end": null,
"feature": "ENST00000233545.6",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000233545.2",
"strand": false,
"transcript": "ENST00000233545.6",
"transcript_support_level": 1
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 171,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 665,
"cdna_start": 168,
"cds_end": null,
"cds_length": 516,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000403262.6",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000385671.1",
"strand": false,
"transcript": "ENST00000403262.6",
"transcript_support_level": 1
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 226,
"aa_ref": "RGLQEHQRG",
"aa_start": 91,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1145,
"cdna_start": 341,
"cds_end": null,
"cds_length": 681,
"cds_start": 272,
"consequences": [
"frameshift_variant"
],
"exon_count": 10,
"exon_rank": 5,
"exon_rank_end": null,
"feature": "ENST00000911060.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.272_297delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg91fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000581119.1",
"strand": false,
"transcript": "ENST00000911060.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 191,
"aa_ref": "RGLQEHQRG",
"aa_start": 56,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 859,
"cdna_start": 209,
"cds_end": null,
"cds_length": 576,
"cds_start": 167,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000405983.5",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.167_192delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg56fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000384586.1",
"strand": false,
"transcript": "ENST00000405983.5",
"transcript_support_level": 5
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 191,
"aa_ref": "RGLQEHQRG",
"aa_start": 56,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1061,
"cdna_start": 257,
"cds_end": null,
"cds_length": 576,
"cds_start": 167,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000931185.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.167_192delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg56fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000601244.1",
"strand": false,
"transcript": "ENST00000931185.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 176,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 977,
"cdna_start": 175,
"cds_end": null,
"cds_length": 531,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000911063.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000581122.1",
"strand": false,
"transcript": "ENST00000911063.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 176,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1070,
"cdna_start": 260,
"cds_end": null,
"cds_length": 531,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000931181.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000601240.1",
"strand": false,
"transcript": "ENST00000931181.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 176,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1191,
"cdna_start": 387,
"cds_end": null,
"cds_length": 531,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000931186.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000601245.1",
"strand": false,
"transcript": "ENST00000931186.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 175,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1018,
"cdna_start": 211,
"cds_end": null,
"cds_length": 528,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000931180.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000601239.1",
"strand": false,
"transcript": "ENST00000931180.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 175,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1007,
"cdna_start": 208,
"cds_end": null,
"cds_length": 528,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000949905.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000619964.1",
"strand": false,
"transcript": "ENST00000949905.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 170,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 906,
"cdna_start": 155,
"cds_end": null,
"cds_length": 513,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 7,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000402310.5",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000383955.1",
"strand": false,
"transcript": "ENST00000402310.5",
"transcript_support_level": 5
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 165,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 950,
"cdna_start": 181,
"cds_end": null,
"cds_length": 498,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 7,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000911062.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000581121.1",
"strand": false,
"transcript": "ENST00000911062.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 165,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1008,
"cdna_start": 237,
"cds_end": null,
"cds_length": 498,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 7,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000931183.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000601242.1",
"strand": false,
"transcript": "ENST00000931183.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 158,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 939,
"cdna_start": 191,
"cds_end": null,
"cds_length": 477,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000911061.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000581120.1",
"strand": false,
"transcript": "ENST00000911061.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 147,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 907,
"cdna_start": 190,
"cds_end": null,
"cds_length": 444,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 7,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000931182.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000601241.1",
"strand": false,
"transcript": "ENST00000931182.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 120,
"aa_ref": "RGLQEHQRG",
"aa_start": 17,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 482,
"cdna_start": 77,
"cds_end": null,
"cds_length": 363,
"cds_start": 50,
"consequences": [
"frameshift_variant"
],
"exon_count": 5,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000430991.5",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.50_75delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg17fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000406441.1",
"strand": false,
"transcript": "ENST00000430991.5",
"transcript_support_level": 5
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 114,
"aa_ref": "RGLQEHQRG",
"aa_start": 15,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 575,
"cdna_start": 297,
"cds_end": null,
"cds_length": 347,
"cds_start": 44,
"consequences": [
"frameshift_variant"
],
"exon_count": 9,
"exon_rank": 5,
"exon_rank_end": null,
"feature": "ENST00000428910.5",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.44_69delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg15fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000405235.1",
"strand": false,
"transcript": "ENST00000428910.5",
"transcript_support_level": 5
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 113,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 603,
"cdna_start": 203,
"cds_end": null,
"cds_length": 342,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 6,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000405076.5",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000385175.1",
"strand": false,
"transcript": "ENST00000405076.5",
"transcript_support_level": 5
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 113,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 831,
"cdna_start": 220,
"cds_end": null,
"cds_length": 342,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 6,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000949904.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000619963.1",
"strand": false,
"transcript": "ENST00000949904.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 99,
"aa_ref": "AGSAGTPERP",
"aa_start": 29,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 827,
"cdna_start": 147,
"cds_end": null,
"cds_length": 300,
"cds_start": 87,
"consequences": [
"frameshift_variant"
],
"exon_count": 6,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000402722.5",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.87_112delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Ser31fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000386000.1",
"strand": false,
"transcript": "ENST00000402722.5",
"transcript_support_level": 3
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 176,
"aa_ref": "RGLQEHQRG",
"aa_start": 41,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1064,
"cdna_start": 260,
"cds_end": null,
"cds_length": 531,
"cds_start": 122,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "XM_005264326.5",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.122_147delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg41fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "XP_005264383.1",
"strand": false,
"transcript": "XM_005264326.5",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 160,
"aa_ref": "RGLQEHQRG",
"aa_start": 25,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1115,
"cdna_start": 311,
"cds_end": null,
"cds_length": 483,
"cds_start": 74,
"consequences": [
"frameshift_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "XM_017004151.2",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.74_99delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": "p.Arg25fs",
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "XP_016859640.1",
"strand": false,
"transcript": "XM_017004151.2",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 199,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 1044,
"cdna_start": null,
"cds_end": null,
"cds_length": 600,
"cds_start": null,
"consequences": [
"intron_variant"
],
"exon_count": 9,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000931184.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.256-286_256-261delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": 4,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000601243.1",
"strand": false,
"transcript": "ENST00000931184.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 152,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 923,
"cdna_start": null,
"cds_end": null,
"cds_length": 459,
"cds_start": null,
"consequences": [
"intron_variant"
],
"exon_count": 7,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000949903.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.71-242_71-217delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": 2,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000619962.1",
"strand": false,
"transcript": "ENST00000949903.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 120,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 2011,
"cdna_start": null,
"cds_end": null,
"cds_length": 363,
"cds_start": null,
"consequences": [
"intron_variant"
],
"exon_count": 6,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000357186.10",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "c.19-286_19-261delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": 1,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000349713.6",
"strand": false,
"transcript": "ENST00000357186.10",
"transcript_support_level": 2
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 905,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 8,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000426513.6",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "n.87_112delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000403824.2",
"strand": false,
"transcript": "ENST00000426513.6",
"transcript_support_level": 3
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "retained_intron",
"canonical": false,
"cdna_end": null,
"cdna_length": 546,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 3,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000616446.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "n.99_124delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "ENST00000616446.1",
"transcript_support_level": 2
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "retained_intron",
"canonical": false,
"cdna_end": null,
"cdna_length": 2315,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 1,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000616707.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "n.330_355delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "ENST00000616707.1",
"transcript_support_level": 6
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "retained_intron",
"canonical": false,
"cdna_end": null,
"cdna_length": 965,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 5,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000617583.4",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "n.148_173delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "ENST00000617583.4",
"transcript_support_level": 2
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "retained_intron",
"canonical": false,
"cdna_end": null,
"cdna_length": 896,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 7,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000621183.4",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "n.178_203delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "ENST00000621183.4",
"transcript_support_level": 5
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "retained_intron",
"canonical": false,
"cdna_end": null,
"cdna_length": 671,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 5,
"exon_rank": 3,
"exon_rank_end": null,
"feature": "ENST00000621470.4",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "n.138_163delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "ENST00000621470.4",
"transcript_support_level": 3
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "retained_intron",
"canonical": false,
"cdna_end": null,
"cdna_length": 794,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 6,
"exon_rank": 4,
"exon_rank_end": null,
"feature": "ENST00000622003.4",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "n.295_320delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "ENST00000622003.4",
"transcript_support_level": 5
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 597,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"intron_variant"
],
"exon_count": 8,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000415514.5",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "n.228-286_228-261delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": 3,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000388043.1",
"strand": false,
"transcript": "ENST00000415514.5",
"transcript_support_level": 5
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "retained_intron",
"canonical": false,
"cdna_end": null,
"cdna_length": 503,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 3,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000475085.1",
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"hgvs_c": "n.-72_-47delGGGGTCTGCAGGAACACCAGAGAGGC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000475085.1",
"transcript_support_level": 2
}
],
"custom_annotations": null,
"dbscsnv_ada_prediction": null,
"dbscsnv_ada_score": null,
"dbsnp": "rs397507438",
"effect": "frameshift_variant",
"frequency_reference_population": null,
"gene_hgnc_id": 7224,
"gene_symbol": "MPV17",
"gnomad_exomes_ac": null,
"gnomad_exomes_af": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_ac": null,
"gnomad_genomes_af": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_heteroplasmic": null,
"gnomad_mito_homoplasmic": null,
"hom_count_reference_population": 0,
"mitotip_prediction": null,
"mitotip_score": null,
"pathogenicity_classification_combined": "Pathogenic",
"phenotype_combined": "Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)",
"phylop100way_prediction": "Uncertain_significance",
"phylop100way_score": 5.189,
"pos": 27313032,
"ref": "GGCCTCTCTGGTGTTCCTGCAGACCCC",
"revel_prediction": null,
"revel_score": null,
"splice_prediction_selected": null,
"splice_score_selected": null,
"splice_source_selected": null,
"spliceai_max_prediction": null,
"spliceai_max_score": null,
"transcript": "NM_002437.5"
}
]
}