← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 22-26483980-GGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGGGAGA-G (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=22&pos=26483980&ref=GGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGGGAGA&alt=G&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "22",
"pos": 26483980,
"ref": "GGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGGGAGA",
"alt": "G",
"effect": "disruptive_inframe_deletion",
"transcript": "NM_001013694.3",
"consequences": [
{
"aa_ref": "GREAAPRGREAAPRG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SRRD",
"gene_hgnc_id": 33910,
"hgvs_c": "c.108_149delGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGG",
"hgvs_p": "p.Arg37_Gly50del",
"transcript": "NM_001013694.3",
"protein_id": "NP_001013716.2",
"transcript_support_level": null,
"aa_start": 36,
"aa_end": null,
"aa_length": 339,
"cds_start": 108,
"cds_end": null,
"cds_length": 1020,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000215917.11",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001013694.3"
},
{
"aa_ref": "GREAAPRGREAAPRG",
"aa_alt": "G",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SRRD",
"gene_hgnc_id": 33910,
"hgvs_c": "c.108_149delGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGG",
"hgvs_p": "p.Arg37_Gly50del",
"transcript": "ENST00000215917.11",
"protein_id": "ENSP00000215917.6",
"transcript_support_level": 1,
"aa_start": 36,
"aa_end": null,
"aa_length": 339,
"cds_start": 108,
"cds_end": null,
"cds_length": 1020,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "NM_001013694.3",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000215917.11"
},
{
"aa_ref": "GREAAPRGREAAPRG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SRRD",
"gene_hgnc_id": 33910,
"hgvs_c": "c.108_149delGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGG",
"hgvs_p": "p.Arg37_Gly50del",
"transcript": "ENST00000942937.1",
"protein_id": "ENSP00000612996.1",
"transcript_support_level": null,
"aa_start": 36,
"aa_end": null,
"aa_length": 365,
"cds_start": 108,
"cds_end": null,
"cds_length": 1098,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000942937.1"
},
{
"aa_ref": "GREAAPRGREAAPRG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SRRD",
"gene_hgnc_id": 33910,
"hgvs_c": "c.108_149delGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGG",
"hgvs_p": "p.Arg37_Gly50del",
"transcript": "ENST00000885114.1",
"protein_id": "ENSP00000555173.1",
"transcript_support_level": null,
"aa_start": 36,
"aa_end": null,
"aa_length": 348,
"cds_start": 108,
"cds_end": null,
"cds_length": 1047,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000885114.1"
},
{
"aa_ref": "GREAAPRGREAAPRG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SRRD",
"gene_hgnc_id": 33910,
"hgvs_c": "c.108_149delGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGG",
"hgvs_p": "p.Arg37_Gly50del",
"transcript": "ENST00000942938.1",
"protein_id": "ENSP00000612997.1",
"transcript_support_level": null,
"aa_start": 36,
"aa_end": null,
"aa_length": 317,
"cds_start": 108,
"cds_end": null,
"cds_length": 954,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000942938.1"
},
{
"aa_ref": "GREAAPRGREAAPRG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SRRD",
"gene_hgnc_id": 33910,
"hgvs_c": "c.108_149delGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGG",
"hgvs_p": "p.Arg37_Gly50del",
"transcript": "ENST00000885115.1",
"protein_id": "ENSP00000555174.1",
"transcript_support_level": null,
"aa_start": 36,
"aa_end": null,
"aa_length": 307,
"cds_start": 108,
"cds_end": null,
"cds_length": 924,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000885115.1"
},
{
"aa_ref": "GREAAPRGREAAPRG",
"aa_alt": "G",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_deletion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SRRD",
"gene_hgnc_id": 33910,
"hgvs_c": "c.108_149delGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGG",
"hgvs_p": "p.Arg37_Gly50del",
"transcript": "XM_017028799.3",
"protein_id": "XP_016884288.1",
"transcript_support_level": null,
"aa_start": 36,
"aa_end": null,
"aa_length": 226,
"cds_start": 108,
"cds_end": null,
"cds_length": 681,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_017028799.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "SRRD",
"gene_hgnc_id": 33910,
"hgvs_c": "c.-152_-111delGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGG",
"hgvs_p": null,
"transcript": "XM_011530178.3",
"protein_id": "XP_011528480.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 268,
"cds_start": null,
"cds_end": null,
"cds_length": 807,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_011530178.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_022081.6",
"protein_id": "NP_071364.4",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000398145.7",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_022081.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000398145.7",
"protein_id": "ENSP00000381213.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "NM_022081.6",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000398145.7"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000439453.5",
"protein_id": "ENSP00000406764.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000439453.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-185_-144delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000466781.5",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000466781.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001349900.2",
"protein_id": "NP_001336829.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 726,
"cds_start": null,
"cds_end": null,
"cds_length": 2181,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001349900.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001349901.1",
"protein_id": "NP_001336830.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 726,
"cds_start": null,
"cds_end": null,
"cds_length": 2181,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001349901.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000422379.3",
"protein_id": "ENSP00000415081.3",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 726,
"cds_start": null,
"cds_end": null,
"cds_length": 2181,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000422379.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000885020.1",
"protein_id": "ENSP00000555079.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 726,
"cds_start": null,
"cds_end": null,
"cds_length": 2181,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000885020.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000885021.1",
"protein_id": "ENSP00000555080.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 726,
"cds_start": null,
"cds_end": null,
"cds_length": 2181,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000885021.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001349896.1",
"protein_id": "NP_001336825.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001349896.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-955_-914delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001349898.2",
"protein_id": "NP_001336827.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001349898.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001349899.2",
"protein_id": "NP_001336828.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001349899.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000336873.9",
"protein_id": "ENSP00000338457.5",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000336873.9"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-955_-914delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000473782.2",
"protein_id": "ENSP00000514223.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000473782.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-864_-823delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000885018.1",
"protein_id": "ENSP00000555077.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000885018.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000885019.1",
"protein_id": "ENSP00000555078.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000885019.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-689_-648delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000940090.1",
"protein_id": "ENSP00000610149.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000940090.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-884_-843delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000940092.1",
"protein_id": "ENSP00000610151.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000940092.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001410832.1",
"protein_id": "NP_001397761.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 680,
"cds_start": null,
"cds_end": null,
"cds_length": 2043,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001410832.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699251.1",
"protein_id": "ENSP00000514238.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 680,
"cds_start": null,
"cds_end": null,
"cds_length": 2043,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000699251.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699242.1",
"protein_id": "ENSP00000514231.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 678,
"cds_start": null,
"cds_end": null,
"cds_length": 2037,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000699242.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699244.1",
"protein_id": "ENSP00000514233.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 659,
"cds_start": null,
"cds_end": null,
"cds_length": 1980,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000699244.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001349904.2",
"protein_id": "NP_001336833.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 655,
"cds_start": null,
"cds_end": null,
"cds_length": 1968,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001349904.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001349905.1",
"protein_id": "NP_001336834.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 655,
"cds_start": null,
"cds_end": null,
"cds_length": 1968,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001349905.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001349902.1",
"protein_id": "NP_001336831.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 649,
"cds_start": null,
"cds_end": null,
"cds_length": 1950,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001349902.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NM_001349903.2",
"protein_id": "NP_001336832.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 649,
"cds_start": null,
"cds_end": null,
"cds_length": 1950,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001349903.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-689_-648delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699250.1",
"protein_id": "ENSP00000514237.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 649,
"cds_start": null,
"cds_end": null,
"cds_length": 1950,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000699250.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-1440_-1399delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000483631.2",
"protein_id": "ENSP00000514228.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": 443,
"cds_start": null,
"cds_end": null,
"cds_length": 1332,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000483631.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-1458_-1417delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699235.1",
"protein_id": "ENSP00000514224.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 443,
"cds_start": null,
"cds_end": null,
"cds_length": 1332,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000699235.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000885022.1",
"protein_id": "ENSP00000555081.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 404,
"cds_start": null,
"cds_end": null,
"cds_length": 1215,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000885022.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699247.1",
"protein_id": "ENSP00000514235.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 360,
"cds_start": null,
"cds_end": null,
"cds_length": 1083,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000699247.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000940091.1",
"protein_id": "ENSP00000610150.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 360,
"cds_start": null,
"cds_end": null,
"cds_length": 1083,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000940091.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000960275.1",
"protein_id": "ENSP00000630334.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 324,
"cds_start": null,
"cds_end": null,
"cds_length": 975,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000960275.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_011530486.3",
"protein_id": "XP_011528788.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 752,
"cds_start": null,
"cds_end": null,
"cds_length": 2259,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_011530486.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_011530490.4",
"protein_id": "XP_011528792.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 734,
"cds_start": null,
"cds_end": null,
"cds_length": 2205,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_011530490.4"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441561.1",
"protein_id": "XP_047297517.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 726,
"cds_start": null,
"cds_end": null,
"cds_length": 2181,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441561.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-955_-914delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441562.1",
"protein_id": "XP_047297518.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 726,
"cds_start": null,
"cds_end": null,
"cds_length": 2181,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441562.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-864_-823delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441563.1",
"protein_id": "XP_047297519.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 726,
"cds_start": null,
"cds_end": null,
"cds_length": 2181,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441563.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-864_-823delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441564.1",
"protein_id": "XP_047297520.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 708,
"cds_start": null,
"cds_end": null,
"cds_length": 2127,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441564.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441565.1",
"protein_id": "XP_047297521.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 698,
"cds_start": null,
"cds_end": null,
"cds_length": 2097,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441565.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441566.1",
"protein_id": "XP_047297522.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 698,
"cds_start": null,
"cds_end": null,
"cds_length": 2097,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441566.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441567.1",
"protein_id": "XP_047297523.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 698,
"cds_start": null,
"cds_end": null,
"cds_length": 2097,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441567.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_017029046.3",
"protein_id": "XP_016884535.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 680,
"cds_start": null,
"cds_end": null,
"cds_length": 2043,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_017029046.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441568.1",
"protein_id": "XP_047297524.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 680,
"cds_start": null,
"cds_end": null,
"cds_length": 2043,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441568.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-955_-914delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441569.1",
"protein_id": "XP_047297525.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 680,
"cds_start": null,
"cds_end": null,
"cds_length": 2043,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441569.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441571.1",
"protein_id": "XP_047297527.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 673,
"cds_start": null,
"cds_end": null,
"cds_length": 2022,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441571.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441572.1",
"protein_id": "XP_047297528.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 673,
"cds_start": null,
"cds_end": null,
"cds_length": 2022,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441572.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-955_-914delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441573.1",
"protein_id": "XP_047297529.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 673,
"cds_start": null,
"cds_end": null,
"cds_length": 2022,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441573.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441574.1",
"protein_id": "XP_047297530.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 673,
"cds_start": null,
"cds_end": null,
"cds_length": 2022,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441574.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441575.1",
"protein_id": "XP_047297531.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 667,
"cds_start": null,
"cds_end": null,
"cds_length": 2004,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441575.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441576.1",
"protein_id": "XP_047297532.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 667,
"cds_start": null,
"cds_end": null,
"cds_length": 2004,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441576.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441577.1",
"protein_id": "XP_047297533.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 667,
"cds_start": null,
"cds_end": null,
"cds_length": 2004,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441577.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-955_-914delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441578.1",
"protein_id": "XP_047297534.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 655,
"cds_start": null,
"cds_end": null,
"cds_length": 1968,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441578.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441579.1",
"protein_id": "XP_047297535.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 655,
"cds_start": null,
"cds_end": null,
"cds_length": 1968,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441579.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-864_-823delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441580.1",
"protein_id": "XP_047297536.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 655,
"cds_start": null,
"cds_end": null,
"cds_length": 1968,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441580.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-955_-914delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441581.1",
"protein_id": "XP_047297537.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 649,
"cds_start": null,
"cds_end": null,
"cds_length": 1950,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441581.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441582.1",
"protein_id": "XP_047297538.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 649,
"cds_start": null,
"cds_end": null,
"cds_length": 1950,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441582.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "c.-864_-823delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XM_047441583.1",
"protein_id": "XP_047297539.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 649,
"cds_start": null,
"cds_end": null,
"cds_length": 1950,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "XM_047441583.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-186_-145delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000479064.5",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000479064.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000491142.2",
"protein_id": "ENSP00000514221.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000491142.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699227.1",
"protein_id": "ENSP00000514220.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000699227.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-186_-145delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699228.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000699228.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699236.1",
"protein_id": "ENSP00000514225.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000699236.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699237.1",
"protein_id": "ENSP00000514226.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000699237.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699238.1",
"protein_id": "ENSP00000514227.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000699238.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-179_-138delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699239.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000699239.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699240.1",
"protein_id": "ENSP00000514229.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000699240.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699241.1",
"protein_id": "ENSP00000514230.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000699241.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-756_-715delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699243.1",
"protein_id": "ENSP00000514232.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000699243.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699246.1",
"protein_id": "ENSP00000514234.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000699246.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-736_-695delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699249.1",
"protein_id": "ENSP00000514236.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000699249.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-186_-145delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699252.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000699252.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-166_-125delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699253.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000699253.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-219_-178delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699256.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000699256.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-213_-172delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "ENST00000699257.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000699257.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-159_-118delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NR_073135.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_073135.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NR_146311.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_146311.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-159_-118delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NR_146312.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_146312.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NR_146313.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_146313.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-159_-118delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NR_146314.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_146314.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NR_146315.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_146315.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "NR_146316.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_146316.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XR_001755361.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "XR_001755361.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-159_-118delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XR_001755364.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "XR_001755364.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-159_-118delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XR_007067983.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "XR_007067983.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XR_007067984.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "XR_007067984.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-159_-118delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XR_007067985.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "XR_007067985.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XR_007067986.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "XR_007067986.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XR_007067987.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "XR_007067987.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XR_007067988.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "XR_007067988.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "HPS4",
"gene_hgnc_id": 15844,
"hgvs_c": "n.-239_-198delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null,
"transcript": "XR_007067989.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "XR_007067989.1"
}
],
"gene_symbol": "SRRD",
"gene_hgnc_id": 33910,
"dbsnp": "rs66831137",
"frequency_reference_population": 0.00069731975,
"hom_count_reference_population": 4,
"allele_count_reference_population": 930,
"gnomad_exomes_af": 0.000727929,
"gnomad_genomes_af": 0.000447116,
"gnomad_exomes_ac": 865,
"gnomad_genomes_ac": 65,
"gnomad_exomes_homalt": 4,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.735,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -2,
"acmg_classification": "Likely_benign",
"acmg_criteria": "PM4,BS2",
"acmg_by_gene": [
{
"score": -2,
"benign_score": 4,
"pathogenic_score": 2,
"criteria": [
"PM4",
"BS2"
],
"verdict": "Likely_benign",
"transcript": "NM_001013694.3",
"gene_symbol": "SRRD",
"hgnc_id": 33910,
"effects": [
"disruptive_inframe_deletion"
],
"inheritance_mode": "AR",
"hgvs_c": "c.108_149delGAGAGAGGCGGCGCCCCGGGGGAGAGAGGCGGCGCCCCGGGG",
"hgvs_p": "p.Arg37_Gly50del"
},
{
"score": -8,
"benign_score": 8,
"pathogenic_score": 0,
"criteria": [
"BS1",
"BS2"
],
"verdict": "Benign",
"transcript": "NM_001349900.2",
"gene_symbol": "HPS4",
"hgnc_id": 15844,
"effects": [
"upstream_gene_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.-827_-786delTCTCCCCCGGGGCGCCGCCTCTCTCCCCCGGGGCGCCGCCTC",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}