← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 22-45795354-G-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=22&pos=45795354&ref=G&alt=GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT&genome=hg38&allGenes=true"
API Response
json
{
"variants": [
{
"chr": "22",
"pos": 45795354,
"ref": "G",
"alt": "GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"effect": "intron_variant",
"transcript": "ENST00000252934.10",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"hgvs_c": "c.1174-11579_1174-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null,
"transcript": "NM_013236.4",
"protein_id": "NP_037368.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 475,
"cds_start": -4,
"cds_end": null,
"cds_length": 1428,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3294,
"mane_select": "ENST00000252934.10",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"hgvs_c": "c.1174-11605_1174-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null,
"transcript": "ENST00000252934.10",
"protein_id": "ENSP00000252934.4",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 475,
"cds_start": -4,
"cds_end": null,
"cds_length": 1428,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3294,
"mane_select": "NM_013236.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"hgvs_c": "c.982-11579_982-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null,
"transcript": "NM_001167621.2",
"protein_id": "NP_001161093.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 411,
"cds_start": -4,
"cds_end": null,
"cds_length": 1236,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3102,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 8,
"intron_rank_end": null,
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"hgvs_c": "c.982-11605_982-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null,
"transcript": "ENST00000381061.8",
"protein_id": "ENSP00000370449.4",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 411,
"cds_start": -4,
"cds_end": null,
"cds_length": 1236,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3135,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"hgvs_c": "c.430-11605_430-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null,
"transcript": "ENST00000435026.5",
"protein_id": "ENSP00000391117.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": 197,
"cds_start": -4,
"cds_end": null,
"cds_length": 594,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 653,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"hgvs_c": "c.126+1576_126+1577insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null,
"transcript": "ENST00000402380.3",
"protein_id": "ENSP00000385624.3",
"transcript_support_level": 4,
"aa_start": null,
"aa_end": null,
"aa_length": 126,
"cds_start": -4,
"cds_end": null,
"cds_length": 381,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 564,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"hgvs_c": "n.272-11605_272-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null,
"transcript": "ENST00000451241.2",
"protein_id": null,
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 514,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"hgvs_c": "n.363-11605_363-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null,
"transcript": "ENST00000493643.3",
"protein_id": null,
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 617,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"hgvs_c": "c.1174-11579_1174-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null,
"transcript": "XM_047441314.1",
"protein_id": "XP_047297270.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 524,
"cds_start": -4,
"cds_end": null,
"cds_length": 1575,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2069,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "ATXN10",
"gene_hgnc_id": 10549,
"dbsnp": "rs60726084",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.237,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000252934.10",
"gene_symbol": "ATXN10",
"hgnc_id": 10549,
"effects": [
"intron_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.1174-11605_1174-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}