← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 22-45795354-G-GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=22&pos=45795354&ref=G&alt=GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "22",
      "pos": 45795354,
      "ref": "G",
      "alt": "GATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
      "effect": "intron_variant",
      "transcript": "NM_013236.4",
      "consequences": [
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": 9,
          "intron_rank_end": null,
          "gene_symbol": "ATXN10",
          "gene_hgnc_id": 10549,
          "hgvs_c": "c.1174-11584_1174-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null,
          "transcript": "NM_013236.4",
          "protein_id": "NP_037368.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 475,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1428,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": "ENST00000252934.10",
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_013236.4"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": 9,
          "intron_rank_end": null,
          "gene_symbol": "ATXN10",
          "gene_hgnc_id": 10549,
          "hgvs_c": "c.1174-11605_1174-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null,
          "transcript": "ENST00000252934.10",
          "protein_id": "ENSP00000252934.4",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 475,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1428,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": "NM_013236.4",
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000252934.10"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": 8,
          "intron_rank_end": null,
          "gene_symbol": "ATXN10",
          "gene_hgnc_id": 10549,
          "hgvs_c": "c.982-11584_982-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null,
          "transcript": "NM_001167621.2",
          "protein_id": "NP_001161093.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 411,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1236,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001167621.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": 8,
          "intron_rank_end": null,
          "gene_symbol": "ATXN10",
          "gene_hgnc_id": 10549,
          "hgvs_c": "c.982-11605_982-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null,
          "transcript": "ENST00000381061.8",
          "protein_id": "ENSP00000370449.4",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 411,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1236,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000381061.8"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "ATXN10",
          "gene_hgnc_id": 10549,
          "hgvs_c": "c.430-11605_430-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null,
          "transcript": "ENST00000435026.5",
          "protein_id": "ENSP00000391117.1",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 197,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 594,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000435026.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "ATXN10",
          "gene_hgnc_id": 10549,
          "hgvs_c": "c.126+1576_126+1577insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null,
          "transcript": "ENST00000402380.3",
          "protein_id": "ENSP00000385624.3",
          "transcript_support_level": 4,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 126,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 381,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000402380.3"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 12,
          "intron_rank": 9,
          "intron_rank_end": null,
          "gene_symbol": "ATXN10",
          "gene_hgnc_id": 10549,
          "hgvs_c": "c.1174-11584_1174-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null,
          "transcript": "XM_047441314.1",
          "protein_id": "XP_047297270.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 524,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1575,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "XM_047441314.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "ATXN10",
          "gene_hgnc_id": 10549,
          "hgvs_c": "n.272-11605_272-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null,
          "transcript": "ENST00000451241.2",
          "protein_id": null,
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "pseudogene",
          "feature": "ENST00000451241.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "ATXN10",
          "gene_hgnc_id": 10549,
          "hgvs_c": "n.363-11605_363-11604insATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null,
          "transcript": "ENST00000493643.3",
          "protein_id": null,
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "pseudogene",
          "feature": "ENST00000493643.3"
        }
      ],
      "gene_symbol": "ATXN10",
      "gene_hgnc_id": 10549,
      "dbsnp": "rs60726084",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 0.237,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 0,
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "",
      "acmg_by_gene": [
        {
          "score": 0,
          "benign_score": 0,
          "pathogenic_score": 0,
          "criteria": [],
          "verdict": "Uncertain_significance",
          "transcript": "NM_013236.4",
          "gene_symbol": "ATXN10",
          "hgnc_id": 10549,
          "effects": [
            "intron_variant"
          ],
          "inheritance_mode": "AD",
          "hgvs_c": "c.1174-11584_1174-11535dupATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCT",
          "hgvs_p": null
        }
      ],
      "clinvar_disease": "",
      "clinvar_classification": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "phenotype_combined": null,
      "pathogenicity_classification_combined": null,
      "custom_annotations": null
    }
  ],
  "message": null
}
For research and educational, non-commercial use only. Not for clinical or diagnostic use. GeneBe does not provide medical advice. Data use for AI modeling is prohibited: if used, the cost is $0.001 per byte of downloaded uncompressed data.